United States
Germany
Japan
United Kingdom
China
JNK2 (MAPK9) (NM_001135044) Human Untagged Clone
CAT＃: SC325650
MAPK9 (untagged)-Human mitogen-activated protein kinase 9 (MAPK9), transcript variant JNK2-g
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
热销推荐Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | JNK-55; JNK2; JNK2A; JNK2ALPHA; JNK2B; JNK2BETA; p54a; p54aSAPK; PRKM9; SAPK; SAPK1a |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001135044, the custom clone sequence may differ by one or more nucleotides
ATGAGCGACAGTAAATGTGACAGTCAGTTTTATAGTGTGCAAGTGGCAGACTCAACCTTC ACTGTCCTAAAACGTTACCAGCAGCTGAAACCAATTGGCTCTGGGGCCCAAGGGATTGTT TGTGCTGCATTTGATACAGTTCTTGGGATAAATGTTGCAGTCAAGAAACTAAGCCGTCCT TTTCAGAACCAAACTCATGCAAAGAGAGCTTATCGTGAACTTGTCCTCTTAAAATGTGTC AATCATAAAAATATAATTAGTTTGTTAAATGTGTTTACACCACAAAAAACTCTAGAAGAA TTTCAAGATGTGTATTTGGTTATGGAATTAATGGATGCTAACTTATGTCAGGTTATTCAC ATGGAGCTGGATCATGAAAGAATGTCCTACCTTCTTTACCAGATGCTTTGTGGTATTAAA CATCTGCATTCAGCTGGTATAATTCATAGAGATTTGAAGCCTAGCAACATTGTTGTGAAA TCAGACTGCACCCTGAAGATCCTTGACTTTGGCCTGGCCCGGACAGCGTGCACTAACTTC ATGATGACCCCTTACGTGGTGACACGGTACTACCGGGCGCCCGAAGTCATCCTGGGTATG GGCTACAAAGAGAACGTTGATATCTGGTCAGTGGGTTGCATCATGGGAGAGCTGGTGAAA GGTTGTGTGATATTCCAAGGCACTGACCGTATCCTTCCCCGCGACCTTGGCCCCGCCATG CTTTCT |
| Restriction Sites | Please inquire |
| ACCN | NM_001135044 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001135044.1, NP_001128516.1 |
| RefSeq Size | 2370 bp |
| RefSeq ORF | 729 bp |
| Locus ID | 5601 |
| UniProt ID | P45984 |
| Protein Families | Druggable Genome, ES Cell Differentiation/IPS, Protein Kinase |
| Protein Pathways | Adipocytokine signaling pathway, Colorectal cancer, Epithelial cell signaling in Helicobacter pylori infection, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, GnRH signaling pathway, Insulin signaling pathway, MAPK signaling pathway, Neurotrophin signaling pathway, NOD-like receptor signaling pathway, Pancreatic cancer, Pathways in cancer, Progesterone-mediated oocyte maturation, RIG-I-like receptor signaling pathway, T cell receptor signaling pathway, Toll-like receptor signaling pathway, Type II diabetes mellitus, Wnt signaling pathway |
| Gene Summary | The protein encoded by this gene is a member of the MAP kinase family. MAP kinases act as an integration point for multiple biochemical signals, and are involved in a wide variety of cellular processes such as proliferation, differentiation, transcription regulation and development. This kinase targets specific transcription factors, and thus mediates immediate-early gene expression in response to various cell stimuli. It is most closely related to MAPK8, both of which are involved in UV radiation induced apoptosis, thought to be related to the cytochrome c-mediated cell death pathway. This gene and MAPK8 are also known as c-Jun N-terminal kinases. This kinase blocks the ubiquitination of tumor suppressor p53, and thus it increases the stability of p53 in nonstressed cells. Studies of this gene's mouse counterpart suggest a key role in T-cell differentiation. Several alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Sep 2008] Transcript Variant: This variant (JNK2-g) differs in the 3' UTR and coding sequence compared to variant JNK2-b2. The resulting isoform (JNK2 gamma) has a shorter and distinct C-terminus compared to isoform JNK2 beta2. Variants JNK2-g and 10 both encode the same isoform (JNK2 gamma). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225304 | MAPK9 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 9 (MAPK9), transcript variant JNK2-g |
CNY 3,990.00 |
|
| RC225304L3 | Lenti-ORF clone of MAPK9 (Myc-DDK-tagged)-Human mitogen-activated protein kinase 9 (MAPK9), transcript variant JNK2-g |
CNY 5,890.00 |
|
| RC225304L4 | Lenti-ORF clone of MAPK9 (mGFP-tagged)-Human mitogen-activated protein kinase 9 (MAPK9), transcript variant JNK2-g |
CNY 5,890.00 |
|
| RG225304 | MAPK9 (tGFP-tagged) - Human mitogen-activated protein kinase 9 (MAPK9), transcript variant JNK2-g |
CNY 4,370.00 |
