EIF4E (NM_001130678) Human Untagged Clone

CAT#: SC325646

EIF4E (untagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3



  "NM_001130678" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
EIF4E mouse monoclonal antibody, clone OTI5D11 (formerly 5D11)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AUTS19; CBP; eIF-4E; EIF4E1; EIF4EL1; EIF4F
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_001130678 edited
TTCATGTTGGACCTGACCTCCCGCGGACAAGTGGGGACGTCCCGGAGGATGGCCGAGGCG
GCGTGTAGCGCACACTTTCTGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAG
GAGAAAACGGAATCTAATCAGGAGGTTGCTAACCCAGAACACTATATTAAACATCCCCTA
CAGAACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCAAAC
CTGCGGCTGATCTCCAAGTTTGATACTGTTGAAGACTTTTGGGCTCTGTACAACCATATC
CAGTTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTTTTAAGGATGGTATTGAG
CCTATGTGGGAAGATGAGAAAAACAAACGGGGAGGACGATGGCTAATTACATTGAACAAA
CAGCAGAGACGAAGTGACCTCGATCGCTTTTGGCTAGAGACACTTCTGTGCCTTATTGGA
GAATCTTTTGATGACTACAGTGATGATGTATGTGGCGCTGTTGTTAATGTTAGAGCTAAA
GGTGATAAGATAGCAATATGGACTACTGAATGTGAAAACAGAGAAGCTGTTACACATATA
GGGAGGGTATACAAGGAAAGGTTAGGACTTCCTCCAAAGATAGTGATTGGTTATCAGTCC
CACGCAGACACAGCTACTAAGAGCGGCTCCACCACTAAAAATAGGTTTGTTGTTTAAGAA
GACACCTTCTGAGTATTCTCATAGGAGACTGCGTCAAGCAATCGAGATTTGGGAGCTGAA
CCAAAGCCTCTTCAAAAAGCAGAGTGGACTGCATTTAAATTTGATTTCCATCTTAATGTT
ACTCAGATATAAGAGAAGTCTCATTCGCCTTTGTCTTGTACTTCTGTGTTCATTTTTTTT
TTTTTTTTTGGCTAGAGTTTCCACTATCCCAATCAAAGAATTACAGTACACATCCCCAGA
ATCCATAAATGTGTTCCTGGCCCACTCTGTAATAGTTCAGTAGAATTACCATTAATTACA
TACAGATTTTACCTATCCACAATAGTCAGAAAACAACTTGGCATTTCTATACTTTACAGG
AAAAAAAATTCTGTTG
Restriction Sites Please inquire     
ACCN NM_001130678
Insert Size 1200 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001130678.1, NP_001124150.1
RefSeq Size 3406 bp
RefSeq ORF 714 bp
Locus ID 1977
UniProt ID P06730
Protein Pathways Insulin signaling pathway, mTOR signaling pathway
Gene Summary The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
Transcript Variant: This variant (3) uses an alternate 5'-terminal exon, which results in a different 5' UTR and use of an alternate translation start codon compared to variant 1. It encodes isoform 3, which has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...