EIF4E (NM_001130678) Human Untagged Clone
CAT#: SC325646
EIF4E (untagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AUTS19; CBP; eIF-4E; EIF4E1; EIF4EL1; EIF4F |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001130678 edited
TTCATGTTGGACCTGACCTCCCGCGGACAAGTGGGGACGTCCCGGAGGATGGCCGAGGCG GCGTGTAGCGCACACTTTCTGGAAACCACCCCTACTCCTAATCCCCCGACTACAGAAGAG GAGAAAACGGAATCTAATCAGGAGGTTGCTAACCCAGAACACTATATTAAACATCCCCTA CAGAACAGATGGGCACTCTGGTTTTTTAAAAATGATAAAAGCAAAACTTGGCAAGCAAAC CTGCGGCTGATCTCCAAGTTTGATACTGTTGAAGACTTTTGGGCTCTGTACAACCATATC CAGTTGTCTAGTAATTTAATGCCTGGCTGTGACTACTCACTTTTTAAGGATGGTATTGAG CCTATGTGGGAAGATGAGAAAAACAAACGGGGAGGACGATGGCTAATTACATTGAACAAA CAGCAGAGACGAAGTGACCTCGATCGCTTTTGGCTAGAGACACTTCTGTGCCTTATTGGA GAATCTTTTGATGACTACAGTGATGATGTATGTGGCGCTGTTGTTAATGTTAGAGCTAAA GGTGATAAGATAGCAATATGGACTACTGAATGTGAAAACAGAGAAGCTGTTACACATATA GGGAGGGTATACAAGGAAAGGTTAGGACTTCCTCCAAAGATAGTGATTGGTTATCAGTCC CACGCAGACACAGCTACTAAGAGCGGCTCCACCACTAAAAATAGGTTTGTTGTTTAAGAA GACACCTTCTGAGTATTCTCATAGGAGACTGCGTCAAGCAATCGAGATTTGGGAGCTGAA CCAAAGCCTCTTCAAAAAGCAGAGTGGACTGCATTTAAATTTGATTTCCATCTTAATGTT ACTCAGATATAAGAGAAGTCTCATTCGCCTTTGTCTTGTACTTCTGTGTTCATTTTTTTT TTTTTTTTTGGCTAGAGTTTCCACTATCCCAATCAAAGAATTACAGTACACATCCCCAGA ATCCATAAATGTGTTCCTGGCCCACTCTGTAATAGTTCAGTAGAATTACCATTAATTACA TACAGATTTTACCTATCCACAATAGTCAGAAAACAACTTGGCATTTCTATACTTTACAGG AAAAAAAATTCTGTTG |
Restriction Sites | Please inquire |
ACCN | NM_001130678 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001130678.1, NP_001124150.1 |
RefSeq Size | 3406 bp |
RefSeq ORF | 714 bp |
Locus ID | 1977 |
UniProt ID | P06730 |
Protein Pathways | Insulin signaling pathway, mTOR signaling pathway |
Gene Summary | The protein encoded by this gene is a component of the eukaryotic translation initiation factor 4F complex, which recognizes the 7-methylguanosine cap structure at the 5' end of messenger RNAs. The encoded protein aids in translation initiation by recruiting ribosomes to the 5'-cap structure. Association of this protein with the 4F complex is the rate-limiting step in translation initiation. This gene acts as a proto-oncogene, and its expression and activation is associated with transformation and tumorigenesis. Several pseudogenes of this gene are found on other chromosomes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015] Transcript Variant: This variant (3) uses an alternate 5'-terminal exon, which results in a different 5' UTR and use of an alternate translation start codon compared to variant 1. It encodes isoform 3, which has a distinct N-terminus compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because transcript sequence consistent with the reference genome assembly was not available for all regions of the RefSeq transcript. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225298 | EIF4E (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3 |
CNY 3,990.00 |
|
RC225298L3 | Lenti-ORF clone of EIF4E (Myc-DDK-tagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3 |
CNY 5,890.00 |
|
RC225298L4 | Lenti-ORF clone of EIF4E (mGFP-tagged)-Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3 |
CNY 5,890.00 |
|
RG225298 | EIF4E (tGFP-tagged) - Human eukaryotic translation initiation factor 4E (EIF4E), transcript variant 3 |
CNY 4,370.00 |