HSD3B7 (NM_001142777) Human Untagged Clone
CAT#: SC325588
HSD3B7 (untagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CBAS1; PFIC4; SDR11E3 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142777, the custom clone sequence may differ by one or more nucleotides
ATGGCCGACTCTGCACAGGCCCAGAAGCTGGTGTACCTGGTCACAGGGGGCTGTGGCTTC CTGGGAGAGCACGTGGTGCGAATGCTGCTGCAGCGGGAGCCCCGGCTCGGGGAGCTGCGG GTCTTTGACCAACACCTGGGTCCCTGGCTGGAGGAGCTGAAGACAGGGCCTGTGAGGGTG ACTGCCATCCAGGGGGACGTGACCCAGGCCCATGAGGTGGCAGCAGCTGTGGCCGGAGCC CATGTGGTCATCCACACGGCTGGGCTGGTAGACGTGTTTGGCAGGGCCAGTCCCAAGACC ATCCATGAGGTCAACGTGCAGGGTACCCGGAACGTGATCGAGGCTTGTGTGCAGACCGGA ACACGGTTCCTGGTCTACACCAGCAGCATGGAAGTTGTGGGGCCTAACACCAAAGGTCAC CCCTTCTACAGGGGCAACGAAGACACCCCATACGAAGCAGTGCACAGGCACCCCTATCCT TGCAGCAAGGCCCTGGCCGAGTGGCTGGTCCTGGAGGCCAACGGGAGGAAGGCAATGTTG CCTGGATGCACGTGCTGGCAGCCCGGGAGCTGGAGCAGCGGGCAACCC |
Restriction Sites | Please inquire |
ACCN | NM_001142777 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142777.1, NP_001136249.1 |
RefSeq Size | 2233 bp |
RefSeq ORF | 591 bp |
Locus ID | 80270 |
UniProt ID | Q9H2F3 |
Protein Families | Transmembrane |
Protein Pathways | Metabolic pathways, Primary bile acid biosynthesis |
Gene Summary | This gene encodes an enzyme which is involved in the initial stages of the synthesis of bile acids from cholesterol and a member of the short-chain dehydrogenase/reductase superfamily. The encoded protein is a membrane-associated endoplasmic reticulum protein which is active against 7-alpha hydrosylated sterol substrates. Mutations in this gene are associated with a congenital bile acid synthesis defect which leads to neonatal cholestasis, a form of progressive liver disease. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2008] Transcript Variant: This variant (2) differs in the 5'UTR and lacks an exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1, resulting in a shorter protein (isoform b), compared to isoform a. Variants 2 and 3 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226924 | HSD3B7 (Myc-DDK-tagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2 |
CN¥ 3,990.00 |
|
RC226924L3 | Lenti-ORF clone of HSD3B7 (Myc-DDK-tagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2 |
CN¥ 5,890.00 |
|
RC226924L4 | Lenti-ORF clone of HSD3B7 (mGFP-tagged)-Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2 |
CN¥ 5,890.00 |
|
RG226924 | HSD3B7 (tGFP-tagged) - Human hydroxy-delta-5-steroid dehydrogenase, 3 beta- and steroid delta-isomerase 7 (HSD3B7), transcript variant 2 |
CN¥ 4,370.00 |