GSTM2 (NM_001142368) Human Untagged Clone

CAT#: SC325580

GSTM2 (untagged)-Human glutathione S-transferase mu 2 (muscle) (GSTM2), transcript variant 2



  "NM_001142368" in other vectors (4)

CN¥ 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


GSTM2 rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GST4; GSTM; GSTM2-2; GTHMUS
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325580 representing NM_001142368.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCCCATGACACTGGGGTACTGGAACATCCGCGGGCTGGCCCATTCCATCCGCCTGCTCCTGGAATAC
ACAGACTCAAGCTACGAGGAAAAGAAGTACACGATGGGGGACGCTCCTGATTATGACAGAAGCCAGTGG
CTGAATGAAAAATTCAAGCTGGGCCTGGACTTTCCCAATCTGCCCTACTTGATTGATGGGACTCACAAG
ATCACCCAGAGCAACGCCATCCTGCGGTACATTGCCCGCAAGCACAACCTGTGCGGGGAATCAGAAAAG
GAGCAGATTCGCGAAGACATTTTGGAGAACCAGTTTATGGACAGCCGTATGCAGCTGGCCAAACTCTGC
TATGACCCAGATTTTGAGAAACTGAAACCAGAATACCTGCAGGCACTCCCTGAAATGCTGAAGCTCTAC
TCACAGTTTCTGGGGAAGCAGCCATGGTTTCTTGGGGACAAGATCACCTTTGTGGATTTCATCGCTTAT
GATGTCCTTGAGAGAAACCAAGTATTTGAGCCCAGCTGCCTGGATGCCTTCCCAAACCTGAAGGACTTC
ATCTCCCGATTTGAGCATTCCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142368
Insert Size 576 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142368.1
RefSeq Size 1478 bp
RefSeq ORF 576 bp
Locus ID 2946
UniProt ID P28161
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
MW 22.6 kDa
Gene Summary Cytosolic and membrane-bound forms of glutathione S-transferase are encoded by two distinct supergene families. At present, eight distinct classes of the soluble cytoplasmic mammalian glutathione S-transferases have been identified: alpha, kappa, mu, omega, pi, sigma, theta and zeta. This gene encodes a glutathione S-transferase that belongs to the mu class. The mu class of enzymes functions in the detoxification of electrophilic compounds, including carcinogens, therapeutic drugs, environmental toxins and products of oxidative stress, by conjugation with glutathione. The genes encoding the mu class of enzymes are organized in a gene cluster on chromosome 1p13.3 and are known to be highly polymorphic. These genetic variations can change an individual's susceptibility to carcinogens and toxins as well as affect the toxicity and efficacy of certain drugs. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) uses an alternate splice pattern in the 3' coding region, compared to variant 1. The resulting isoform (2) has a shorter and distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...