Glutathione S Transferase kappa 1 (GSTK1) (NM_001143681) Human Untagged Clone

CAT#: SC325572

GSTK1 (untagged)-Human glutathione S-transferase kappa 1 (GSTK1), nuclear gene encoding mitochondrial protein, transcript variant 4



  "NM_001143681" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
GSTK1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

热销推荐


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GST; GST13; GST 13-13; GST13-13; GSTK1-1; hGSTK1
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325572 representing NM_001143681.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGGCCCCTGCCGCGCACCGTGGAGCTCTTCTATGACGTGCTGTCCCCCTACTCCTGGCTGGGCTTC
GAGATCCTGTGCCGGTATCAGAATATCTGGAACATCAACCTGCAGTTGCGGCCCAGCCTCATAACAGGG
ATCATGAAAGACAGTGGAAGTTTGTCTGCCATGCGTTTCCTCACCGCCGTGAACTTGGAGCATCCAGAG
ATGCTGGAGAAAGCGTCCCGGGAGCTGTGGATGCGCGTCTGGTCAAGGAATGAAGACATCACCGAGCCG
CAGAGCATCCTGGCGGCTGCAGAGAAGGCTGGTATGTCTGCAGAACAAGCCCAGGGACTTCTGGAAAAG
ATCGCAACGCCAAAGGTGAAGAACCAGCTCAAGGAGACCACTGAGGCAGCCTGCAGATACGGAGCCTTT
GGGCTGCCCATCACCGTGGCCCATGTGGATGGCCAAACCCACATGTTATTTGGCTCTGACCGGATGGAG
CTGCTGGCGCACCTGCTGGGAGAGAAGTGGATGGGCCCTATACCTCCAGCCGTGAATGCCAGACTTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001143681
Insert Size 552 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001143681.1
RefSeq Size 929 bp
RefSeq ORF 552 bp
Locus ID 373156
UniProt ID Q9Y2Q3
Protein Pathways Drug metabolism - cytochrome P450, Glutathione metabolism, Metabolism of xenobiotics by cytochrome P450
MW 20.5 kDa
Gene Summary This gene encodes a member of the kappa class of the glutathione transferase superfamily of enzymes that function in cellular detoxification. The encoded protein is localized to the peroxisome and catalyzes the conjugation of glutathione to a wide range of hydrophobic substates facilitating the removal of these compounds from cells. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2009]
Transcript Variant: This variant (4) lacks an exon in the coding region compared to variant 1. The encoded protein (isoform d) is shorter compared to isoform a.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Glutathione S Transferase kappa 1产品

Customer Reviews 
Loading...