FBXO28 (NM_001136115) Human Untagged Clone

CAT#: SC325563

FBXO28 (untagged)-Human F-box protein 28 (FBXO28), transcript variant 2



  "NM_001136115" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal FBXO28 Antibody (C-term)
    • 400 ul

CNY 6,314.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CENP-30; Fbx28
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001136115, the custom clone sequence may differ by one or more nucleotides
ATGGCGGCAGCGGCGGAGGAGCGGATGGCAGAGGAAGGAGGCGGCGGCCAAGGCGACGGC
GGTTCCTCTTTGGCCTCCGGCTCTACCCAGCGACAGCCTCCACCGCCCGCGCCACAGCAC
CCGCAGCCGGGGTCCCAGGCGCTCCCAGCCCCCGCGCTGGCTCCGGACCAGCTGCCTCAA
AACAACACGCTTGTGGCGCTGCCCATCGTAGCCATCGAGAACATCCTCAGCTTTATGTCC
TACGACGAAATTAGCCAGCTCCGCCTGGTTTGTAAAAGAATGGACTTGGTCTGCCAGAGA
ATGTTGAATCAGGGATTTCTGAAAGTGGAGAGGTACCATAATCTATGTCAGAAACAAGTT
AAAGCACAACTCCCAAGGAGAGAGTCAGAAAGGAGAAACCATTCATTAGCTCGTCATGCA
GACATTCTTGCTGCTGTTGAAACAAGGCTGTCACTATTAAATATGACTTTCATGAAATAT
GTGGATTCCAATCTCTGTTGCTTCATCCCAGGAAAGTTCCAGGACCGTCTGCAGCCC
Restriction Sites Please inquire     
ACCN NM_001136115
Insert Size 5263 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001136115.1, NP_001129587.1
RefSeq Size 5263 bp
RefSeq ORF 540 bp
Locus ID 23219
UniProt ID Q9NVF7
Protein Families Druggable Genome
Gene Summary Members of the F-box protein family, such as FBXO28, are characterized by an approximately 40-amino acid F-box motif. SCF complexes, formed by SKP1 (MIM 601434), cullin (see CUL1; MIM 603134), and F-box proteins, act as protein-ubiquitin ligases. F-box proteins interact with SKP1 through the F box, and they interact with ubiquitination targets through other protein interaction domains (Jin et al., 2004 [PubMed 15520277]).[supplied by OMIM, Mar 2008]
Transcript Variant: This variant (2) lacks an exon in the 3' coding region, which results in a frameshift, compared to variant 1. The encoded isoform (b) is shorter and has a distinct C-terminus, compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...