SAP30L (NM_001131063) Human Untagged Clone

CAT#: SC325504

SAP30L (untagged)-Human SAP30-like (SAP30L), transcript variant 3



  "NM_001131063" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


SAP30L rabbit polyclonal antibody
    • 25 ul

CNY 800.00
CNY 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms NS4ATP2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC325504 representing NM_001131063.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGAACGGCTTCAGCACGGAGGAGGACAGCCGCGAAGGGCCCCCCGCCGCCCCAGCTGCCGCCGCCCCG
GGCTACGGCCAGAGCTGCTGCCTCATCGAGGACGGCGAGCGCTGCGTCCGGCCCGCGGGCAACGCCTCC
TTCAGCAAGAGGGTCCAGAAGAGCATCTCGCAGAAGAAACTCAAGCTGGACATCGACAAGAGCCTGCAG
GTGAACACCCTACGACGTTATAAACGACACTACAAGTTGCAGACCAGACCAGGCTTCAATAAGGCCCAG
TTAGCAGAAACTGTGAGTCGACACTTCAGGAACATACCTGTGAATGAAAAAGAGACCCTTGCCTACTTC
ATCTACATGGTGAAGAGTAACAAGAGTAGACTGGACCAGAAATCGGAGGGTGGCAAGCAGCTTGAGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001131063
Insert Size 414 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001131063.1
RefSeq Size 6105 bp
RefSeq ORF 414 bp
Locus ID 79685
UniProt ID Q9HAJ7
MW 15.4 kDa
Gene Summary Isoform 1: Functions as transcription repressor, probably via its interaction with histone deacetylase complexes (PubMed:16820529, PubMed:18070604). Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus (PubMed:16820529). Binds DNA, apparently without sequence-specificity, and bends bound double-stranded DNA (PubMed:19015240). Binds phosphoinositol phosphates (phosphoinositol 3-phosphate, phosphoinositol 4-phosphate and phosphoinositol 5-phosphate) via the same basic sequence motif that mediates DNA binding and nuclear import (PubMed:19015240, PubMed:26609676).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The resulting protein (isoform 3) is shorter than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...