United States
Germany
Japan
United Kingdom
China
SAP30L (NM_001131063) Human Untagged Clone
CAT＃: SC325504
SAP30L (untagged)-Human SAP30-like (SAP30L), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | NS4ATP2 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325504 representing NM_001131063.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAACGGCTTCAGCACGGAGGAGGACAGCCGCGAAGGGCCCCCCGCCGCCCCAGCTGCCGCCGCCCCG GGCTACGGCCAGAGCTGCTGCCTCATCGAGGACGGCGAGCGCTGCGTCCGGCCCGCGGGCAACGCCTCC TTCAGCAAGAGGGTCCAGAAGAGCATCTCGCAGAAGAAACTCAAGCTGGACATCGACAAGAGCCTGCAG GTGAACACCCTACGACGTTATAAACGACACTACAAGTTGCAGACCAGACCAGGCTTCAATAAGGCCCAG TTAGCAGAAACTGTGAGTCGACACTTCAGGAACATACCTGTGAATGAAAAAGAGACCCTTGCCTACTTC ATCTACATGGTGAAGAGTAACAAGAGTAGACTGGACCAGAAATCGGAGGGTGGCAAGCAGCTTGAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001131063 |
| Insert Size | 414 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001131063.1 |
| RefSeq Size | 6105 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 79685 |
| UniProt ID | Q9HAJ7 |
| MW | 15.4 kDa |
| Gene Summary | Isoform 1: Functions as transcription repressor, probably via its interaction with histone deacetylase complexes (PubMed:16820529, PubMed:18070604). Involved in the functional recruitment of the class 1 Sin3-histone deacetylase complex (HDAC) to the nucleolus (PubMed:16820529). Binds DNA, apparently without sequence-specificity, and bends bound double-stranded DNA (PubMed:19015240). Binds phosphoinositol phosphates (phosphoinositol 3-phosphate, phosphoinositol 4-phosphate and phosphoinositol 5-phosphate) via the same basic sequence motif that mediates DNA binding and nuclear import (PubMed:19015240, PubMed:26609676).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (3) lacks an alternate in-frame exon and uses an alternate in-frame splice site, compared to variant 1. The resulting protein (isoform 3) is shorter than isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225107 | SAP30L (Myc-DDK-tagged)-Human SAP30-like (SAP30L), transcript variant 3 |
CNY 1,200.00 |
|
| RC225107L3 | Lenti ORF clone of Human SAP30-like (SAP30L), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225107L4 | Lenti ORF clone of Human SAP30-like (SAP30L), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG225107 | SAP30L (tGFP-tagged) - Human SAP30-like (SAP30L), transcript variant 3 |
CNY 4,370.00 |
