United States
Germany
Japan
United Kingdom
China
ESM1 (NM_001135604) Human Untagged Clone
CAT＃: SC325499
ESM1 (untagged)-Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | endocan |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC325499 representing NM_001135604.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGAGCGTCTTGCTGCTGACCACGCTCCTCGTGCCTGCACACCTGGTGGCCGCCTGGAGCAATAAT TATGCGGTGGACTGCCCTCAACACTGTGACAGCAGTGAGTGCAAAAGCAGCCCGCGCTGCAAGAGGACA GTGCTCGACGACTGTGGCTGCTGCCGAGTGTGCGCTGCAGGGCGGGGAGAAACTTGCTACCGCACAGTC TCAGGCATGGATGGCATGAAGTGTGGCCCGGGGCTGAGGTGTCAGCCTTCTAATGGGGAGGATCCTTTT GGTGAAGAGTTTGGTATCTGCAAAGAGCATGACATGGCATCTGGAGATGGCAATATTGTGAGAGAAGAA GTTGTGAAAGAGAATGCTGCCGGGTCTCCCGTAATGAGGAAATGGTTAAATCCACGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001135604 |
| Insert Size | 405 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001135604.1 |
| RefSeq Size | 1939 bp |
| RefSeq ORF | 405 bp |
| Locus ID | 11082 |
| UniProt ID | Q9NQ30 |
| Protein Families | Druggable Genome, Secreted Protein |
| MW | 14.5 kDa |
| Gene Summary | This gene encodes a secreted protein which is mainly expressed in the endothelial cells in human lung and kidney tissues. The expression of this gene is regulated by cytokines, suggesting that it may play a role in endothelium-dependent pathological disorders. The transcript contains multiple polyadenylation and mRNA instability signals. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (2) lacks an alternate in-frame exon compared to variant 1. The resulting isoform (b) has the same N- and C-termini but is shorter compared to isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227431 | ESM1 (Myc-DDK-tagged)-Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2 |
CNY 1,200.00 |
|
| RC227431L3 | Lenti ORF clone of Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC227431L4 | Lenti ORF clone of Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG227431 | ESM1 (tGFP-tagged) - Human endothelial cell-specific molecule 1 (ESM1), transcript variant 2 |
CNY 4,370.00 |
