GPT2 (NM_001142466) Human Untagged Clone

CAT#: SC325083

GPT2 (untagged)-Human glutamic pyruvate transaminase (alanine aminotransferase) 2 (GPT2), transcript variant 2



  "NM_001142466" in other vectors (4)

CNY 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GPT2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms ALT2; GPT 2; MRT49; NEDSPM
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001142466, the custom clone sequence may differ by one or more nucleotides
ATGGGGCAGCAGCCAATCACCTTCCTCCGGCAGGTGATGGCACTATGCACCTACCCAAAC
CTGCTGGACAGCCCCAGCTTCCCAGAAGATGCTAAGAAACGTGCCCGGCGGATCCTGCAG
GCTTGTGGCGGGAACAGCCTGGGGTCCTACAGTGCTAGCCAGGGTGTCAACTGCATCCGT
GAAGATGTGGCTGCCTACATCACCAGGAGGGATGGCGGTGTGCCTGCGGACCCCGACAAC
ATCTACCTGACCACGGGAGCTAGTGACGGCATTTCTACGATCCTGAAGATCCTCGTCTCC
GGGGGCGGCAAGTCACGGACAGGTGTGATGATCCCCATCCCACAATATCCCCTCTATTCA
GCTGTCATCTCTGAGCTCGACGCCATCCAGGTGAATTACTACCTGGACGAGGAGAACTGC
TGGGCGCTGAATGTGAATGAGCTCCGGCGGGCGGTGCAGGAGGCCAAAGACCACTGTGAT
CCTAAGGTGCTCTGCATAATCAACCCTGGGAACCCCACAGGCCAGGTACAAAGCAGAAAG
TGCATAGAAGATGTGATCCACTTTGCCTGGGAAGAGAAGCTCTTTCTCCTGGCTGATGAG
GTGTACCAGGACAACGTGTACTCTCCAGATTGCAGATTCCACTCCTTCAAGAAGGTGCTG
TACGAGATGGGGCCCGAGTACTCCAGCAACGTGGAGCTCGCCTCCTTCCACTCCACCTCC
AAGGGCTACATGGGCGAGTGTGGTTACAGAGGAGGCTACATGGAGGTGATCAACCTGCAC
CCTGAGATCAAGGGCCAGCTGGTGAAGCTGCTGTCGGTGCGCCTGTGCCCCCCAGTGTCT
GGGCAGGCCGCCATGGACATTGTCGTGAACCCCCCGGTGGCAGGAGAGGAGTCCTTTGAG
CAATTCAGCCGAGAGAAGGAGTCGGTCCTGGGTAATCTGGCCAAAAAAGCAAAGCTGACG
GAAGACCTGTTTAACCAAGTCCCAGGAATTCACTGCAACCCCTTGCAGGGGGCCATGTAC
GCCTTCCCTCGGATCTTCATTCCTGCCAAAGCTGTGGAGGCTGCTCAGGCCCATCAAATG
GCTCCAGACATGTTCTACTGCATGAAGCTCCTGGAGGAGACTGGCATCTGTGTCGTGCCC
GGCAGTGGCTTTGGGCAGAGGGAAGGCACTTACCACTTCAGGATGACTATCCTCCCTCCA
GTGGAGAAGCTGAAAACGGTGCTGCAGAAGGTGAAAGACTTCCACATCAACTTCCTGGAG
AAGTACGCG
Restriction Sites Please inquire     
ACCN NM_001142466
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142466.1, NP_001135938.1
RefSeq Size 3879 bp
RefSeq ORF 1272 bp
Locus ID 84706
UniProt ID Q8TD30
Protein Pathways Alanine, aspartate and glutamate metabolism, Metabolic pathways
Gene Summary This gene encodes a mitochondrial alanine transaminase, a pyridoxal enzyme that catalyzes the reversible transamination between alanine and 2-oxoglutarate to generate pyruvate and glutamate. Alanine transaminases play roles in gluconeogenesis and amino acid metabolism in many tissues including skeletal muscle, kidney, and liver. Activating transcription factor 4 upregulates this gene under metabolic stress conditions in hepatocyte cell lines. A loss of function mutation in this gene has been associated with developmental encephalopathy. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2015]
Transcript Variant: This variant (2) uses alternate exons in the 5' UTR and 5' coding sequence, resulting in use of a downstream start codon compared to variant 1. It encodes isoform 2, which has a shorter N-terminus than isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...