HMBOX1 (NM_001135726) Human Untagged Clone

CAT#: SC325078

HMBOX1 (untagged)-Human homeobox containing 1 (HMBOX1), transcript variant 2



  "NM_001135726" in other vectors (4)

CNY 3,656.00

CNY 7,220.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


HMBOX1 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HNF1LA; HOT1; PBHNF; TAH1
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001135726 edited
ATGCTTAGTTCCTTTCCAGTGGTTTTGCTGGAAACCATGTCTCATTATACAGATGAACCC
AGATTTACCATAGAGCAGATAGATCTGCTTCAGCGACTTCGGCGTACTGGAATGACTAAA
CATGAAATTCTCCATGCCTTGGAAACTTTGGACCGTCTTGATCAAGAGCATAGTGACAAG
TTTGGAAGAAGGTCCAGCTATGGAGGAAGTTCATATGGGAATAGTACTAACAATGTCCCA
GCATCTTCCTCTACAGCTACAGCTTCCACACAGACGCAGCATTCGGGAATGTCCCCGTCA
CCTAGCAACAGTTATGATACTTCCCCACAGCCTTGCACTACCAATCAAAATGGGAGGGAG
AATAATGAGCGATTATCTACATCCAATGGAAAGATGTCACCAACTCGCTACCATGCAAAC
AGCATGGGTCAGAGGTCATACAGTTTTGAAGCCTCAGAAGAGGACCTAGATGTAGATGAT
AAAGTGGAAGAATTAATGAGGAGGGACAGCAGTGTGATAAAAGAGGAAATCAAAGCCTTT
CTTGCCAATCGGAGGATTTCCCAAGCAGTTGTTGCACAGGTAACAGGTATCAGTCAGAGC
CGGATCTCTCATTGGCTGTTGCAGCAGGGATCAGACCTGAGTGAACAGAAGAAAAGAGCA
TTTTACCGATGGTATCAACTTGAGAAGACAAACCCTGGCGCTACACTAAGTATGAGACCA
GCCCCCATTCCAATAGAGGACCCTGAATGGAGACAAACGCCTCCCCCAGTCTCTGCCACA
TCTGGTACTTTCCGACTGCGACGAGGGAGTCGATTTACCTGGAGAAAGGAGTGCCTGGCT
GTTATGGAAAGTTACTTCAATGAGAATCAATACCCAGATGAAGCAAAGAGGGAAGAAATT
GCAAACGCTTGCAATGCAGTTATACAGAAGCCAGGCAAAAAGCTGTCAGATCTGGAAAGA
GTTACCTCCCTGAAAGTATATAATTGGTTTGCTAACAGAAGGAAGGAGATCAAGAGGAGA
GCCAATATTGAAGCAGCAATCCTGGAGAGTCATGGGATAGATGTGCAGAGTCCAGGAGGC
CACTCAAACAGTGATGATGTCGACGGGAATGACTACTCTGAGCAGGATGACAGTACGAGC
CATAGTGACCACCAAGACCCCATCTCATTAGCTGTGGAAATGGCAGCAGTCAACCACACT
ATCTTGGCATTGGCCCGACAAGGAGCCAACGAAATCAAGACAGAGGCCCTGGATGATGAC
TGA
Restriction Sites NotI-NotI     
ACCN NM_001135726
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001135726.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001135726.1, NP_001129198.1
RefSeq Size 3175 bp
RefSeq ORF 1263 bp
Locus ID 79618
UniProt ID Q6NT76
Protein Families Transcription Factors
Gene Summary Binds directly to 5'-TTAGGG-3' repeats in telomeric DNA (PubMed:23813958, PubMed:23685356). Associates with the telomerase complex at sites of active telomere processing and positively regulates telomere elongation (PubMed:23685356). Important for TERT binding to chromatin, indicating a role in recruitment of the telomerase complex to telomeres (By similarity). Also plays a role in the alternative lengthening of telomeres (ALT) pathway in telomerase-negative cells where it promotes formation and/or maintenance of ALT-associated promyelocytic leukemia bodies (APBs) (PubMed:23813958). Enhances formation of telomere C-circles in ALT cells, suggesting a possible role in telomere recombination (PubMed:23813958). Might also be involved in the DNA damage response at telomeres (PubMed:23813958).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Variants 1, 2, and 3 all encode the same isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...