United States
Germany
Japan
United Kingdom
China
CMKLR1 (NM_001142343) Human Untagged Clone
CAT＃: SC325013
CMKLR1 (untagged)-Human chemokine-like receptor 1 (CMKLR1), transcript variant 1
CNY 7,220.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CHEMERINR; ChemR23; DEZ; RVER1 |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001142343, the custom clone sequence may differ by one or more nucleotides
ATGAGAATGGAGGATGAAGATTACAACACTTCCATCAGTTACGGTGATGAATACCCTGAT TATTTAGACTCCATTGTGGTTTTGGAGGACTTATCCCCCTTGGAAGCCAGGGTGACCAGG ATCTTCCTGGTGGTGGTCTACAGCATCGTCTGCTTCCTCGGGATTCTGGGCAATGGTCTG GTGATCATCATTGCCACCTTCAAGATGAAGAAGACAGTGAACATGGTCTGGTTCCTCAAC CTGGCAGTGGCAGATTTCCTGTTCAACGTCTTCCTCCCAATCCATATCACCTATGCCGCC ATGGACTACCACTGGGTTTTCGGGACAGCCATGTGCAAGATCAGCAACTTCCTTCTCATC CACAACATGTTCACCAGCGTCTTCCTGCTGACCATCATCAGCTCTGACCGCTGCATCTCT GTGCTCCTCCCTGTCTGGTCCCAGAACCACCGCAGCGTTCGCCTGGCTTACATGGCCTGC ATGGTCATCTGGGTCCTGGCTTTCTTCTTGAGTTCCCCATCTCTCGTCTTCCGGGACACA GCCAACCTGCATGGGAAAATATCCTGCTTCAACAACTTCAGCCTGTCCACACCTGGGTCT TCCTCGTGGCCCACTCACTCCCAAATGGACCCTGTGGGGTATAGCCGGCACATGGTGGTG ACTGTCACCCGCTTCCTCTGTGGCTTCCTGGTCCCAGTCCTCATCATCACAGCTTGCTAC CTCACCATCGTGTGCAAACTGCAGCGCAACCGCCTGGCCAAGACCAAGAAGCCCTTCAAG ATTATTGTGACCATCATCATTACCTTCTTCCTCTGCTGGTGCCCCTACCACACACTCAAC CTCCTAGAGCTCCACCACACTGCCATGCCTGGCTCTGTCTTCAGCCTGGGTTTGCCCCTG GCCACTGCCCTTGCCATTGCCAACAGCTGCATGAACCCCATTCTGTATGTTTTCATGGGT CAGGACTTCAAGAAGTTCAAGGTGGCCCTCTTCTCTCGCCTGGTCAATGCTCTAAGTGAA GATACAGGCCACTCTTCCTACCCCAGCCATAGAAGCTTTACCAAGATGTCATCAATGAAT GAGAGGACTTCTATGAATGAGAGGGAGACCGGCATGCTT |
| Restriction Sites | Please inquire |
| ACCN | NM_001142343 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001142343.1, NP_001135815.1 |
| RefSeq Size | 5496 bp |
| RefSeq ORF | 1122 bp |
| Locus ID | 1240 |
| UniProt ID | Q99788 |
| Protein Families | Druggable Genome, GPCR, Transmembrane |
| Gene Summary | Receptor for the chemoattractant adipokine chemerin/RARRES2 and for the omega-3 fatty acid derived molecule resolvin E1. Interaction with RARRES2 induces activation of intracellular signaling molecules, such as SKY, MAPK1/3 (ERK1/2), MAPK14/P38MAPK and PI3K leading to multifunctional effects, like, reduction of immune responses, enhancing of adipogenesis and angionesis. Resolvin E1 down-regulates cytokine production in macrophages by reducing the activation of MAPK1/3 (ERK1/2) and NF-kappa-B. Positively regulates adipogenesis and adipocyte metabolism. Acts as a coreceptor for several SIV strains (SIVMAC316, SIVMAC239, SIVMACL7E-FR and SIVSM62A), as well as a primary HIV-1 strain (92UG024-2).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes the longer isoform (a). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227006 | CMKLR1 (Myc-DDK-tagged)-Human chemokine-like receptor 1 (CMKLR1), transcript variant 1 |
CNY 3,990.00 |
|
| RC227006L3 | Lenti-ORF clone of CMKLR1 (Myc-DDK-tagged)-Human chemokine-like receptor 1 (CMKLR1), transcript variant 1 |
CNY 5,890.00 |
|
| RC227006L4 | Lenti-ORF clone of CMKLR1 (mGFP-tagged)-Human chemokine-like receptor 1 (CMKLR1), transcript variant 1 |
CNY 5,890.00 |
|
| RG227006 | CMKLR1 (tGFP-tagged) - Human chemokine-like receptor 1 (CMKLR1), transcript variant 1 |
CNY 7,456.00 |
