SQSTM1 (NM_001142298) Human Untagged Clone

CAT#: SC324988

SQSTM1 (untagged)-Human sequestosome 1 (SQSTM1), transcript variant 2



  "NM_001142298" in other vectors (4)

CN¥ 7,220.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
SQSTM1 mouse monoclonal antibody, clone OTI1E9 (formerly 1E9)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms A170; DMRV; FTDALS3; NADGP; OSIL; p60; p62; p62B; PDB3; ZIP3
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324988 representing NM_001142298.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCCATGTCCTACGTGAAGGATGACATCTTCCGAATCTACATTAAAGAGAAAAAAGAGTGCCGGCGG
GACCACCGCCCACCGTGTGCTCAGGAGGCGCCCCGCAACATGGTGCACCCCAATGTGATCTGCGATGGC
TGCAATGGGCCTGTGGTAGGAACCCGCTACAAGTGCAGCGTCTGCCCAGACTACGACTTGTGTAGCGTC
TGCGAGGGAAAGGGCTTGCACCGGGGGCACACCAAGCTCGCATTCCCCAGCCCCTTCGGGCACCTGTCT
GAGGGCTTCTCGCACAGCCGCTGGCTCCGGAAGGTGAAACACGGACACTTCGGGTGGCCAGGATGGGAA
ATGGGTCCACCAGGAAACTGGAGCCCACGTCCTCCTCGTGCAGGGGAGGCCCGCCCTGGCCCCACGGCA
GAATCAGCTTCTGGTCCATCGGAGGATCCGAGTGTGAATTTCCTGAAGAACGTTGGGGAGAGTGTGGCA
GCTGCCCTTAGCCCTCTGGGCATTGAAGTTGATATCGATGTGGAGCACGGAGGGAAAAGAAGCCGCCTG
ACCCCCGTCTCTCCAGAGAGTTCCAGCACAGAGGAGAAGAGCAGCTCACAGCCAAGCAGCTGCTGCTCT
GACCCCAGCAAGCCGGGTGGGAATGTTGAGGGCGCCACGCAGTCTCTGGCGGAGCAGATGAGGAAGATC
GCCTTGGAGTCCGAGGGGCGCCCTGAGGAACAGATGGAGTCGGATAACTGTTCAGGAGGAGATGATGAC
TGGACCCATCTGTCTTCAAAAGAAGTGGACCCGTCTACAGGTGAACTCCAGTCCCTACAGATGCCAGAA
TCCGAAGGGCCAAGCTCTCTGGACCCCTCCCAGGAGGGACCCACAGGGCTGAAGGAAGCTGCCTTGTAC
CCACATCTCCCGCCAGAGGCTGACCCGCGGCTGATTGAGTCCCTCTCCCAGATGCTGTCCATGGGCTTC
TCTGATGAAGGCGGCTGGCTCACCAGGCTCCTGCAGACCAAGAACTATGACATCGGAGCGGCTCTGGAC
ACCATCCAGTATTCAAAGCATCCCCCGCCGTTGTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001142298
Insert Size 1071 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001142298.1
RefSeq Size 2931 bp
RefSeq ORF 1071 bp
Locus ID 8878
UniProt ID Q13501
Protein Families Druggable Genome, Transcription Factors
MW 38.6 kDa
Gene Summary This gene encodes a multifunctional protein that binds ubiquitin and regulates activation of the nuclear factor kappa-B (NF-kB) signaling pathway. The protein functions as a scaffolding/adaptor protein in concert with TNF receptor-associated factor 6 to mediate activation of NF-kB in response to upstream signals. Alternatively spliced transcript variants encoding either the same or different isoforms have been identified for this gene. Mutations in this gene result in sporadic and familial Paget disease of bone. [provided by RefSeq, Mar 2009]
Transcript Variant: This variant (2) differs in the 5' UTR, lacks a portion of the 5' coding region, and initiates translation from an in-frame downstream start codon compared to variant 1. This results in an isoform (2) with a shorter N-terminus compared to isoform 1. Variants 2 and 3 encode the same isoform.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...