DHRS9 (NM_001142270) Human Untagged Clone
CAT#: SC324936
DHRS9 (untagged)-Human dehydrogenase/reductase (SDR family) member 9 (DHRS9), transcript variant 3
CNY 6,270.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 3-alpha-HSD; 3ALPHA-HSD; RDH-E2; RDH-TBE; RDH15; RDHL; RDHTBE; RETSDR8; SDR9C4 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001142270, the custom clone sequence may differ by one or more nucleotides
ATGCTCTTTTGGGTGCTAGGCCTCCTAATCCTCTGTGGTTTTCTGTGGACTCGTAAAGGA AAACTAAAGATTGAAGACATCACTGATAAGTACATTTTTATCACTGGATGTGACTCGGGC TTTGGAAACTTGGCAGCCAGAACTTTTGATAAAAAGGGATTTCATGTAATCGCTGCCTGT CTGACTGAATCAGGATCAACAGCTTTAAAGGCAGAAACCTCAGAGAGACTTCGTACTGTG CTTCTGGATGTGACCGACCCAGAGAATGTCAAGAGGACTGCCCAGTGGGTGAAGAACCAA GTTGGGGAGAAAGGTCTCTGGGGTCTGATCAATAATGCTGGTGTTCCCGGCGTGCTGGCT CCCACTGACTGGCTGACACTAGAGGACTACAGAGAACCTATTGAAGTGAACCTGTTTGGA CTCATCAGTGTGACACTAAATATGCTTCCTTTGGTCAAGAAAGCTCAAGGGAGAGTTATT AATGTCTCCAGTGTTGGAGGTCGCCTTGCAATCGTTGGAGGGGGCTATACTCCATCCAAA TATGCAGTGGAAGGTTTCAATGACAGCTTAAGACGGGACATGAAAGCTTTTGGTGTGCAC GTCTCATGCATTGAACCAGGATTGTTCAAAACAAACTTGGCAGATCCAGTAAAGGTAATT GAAAAAAAACTCGCCATTTGGGAGCAGCTGTCTCCAGACATCAAACAACAATATGGAGAA GGTTACATTGAAAAAAGTCTAGACAAACTGAAAGGCAATAAATCCTATGTGAACATGGAC CTCTCTCCGGTGGTAGAGTGCATGGACCACGCTCTAACAAGTCTCTTCCCTAAGACTCAT TATGCCGCTGGAAAAGATGCCAAAATTTTCTGGATACCTCTGTCTCACATGCCAGCAGCT TTGCAAGACTTTTTATTGTTGAAACAGAAAGCAGAGCTGGCTAATCCCAAGGCAGTG |
Restriction Sites | Please inquire |
ACCN | NM_001142270 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001142270.1, NP_001135742.1 |
RefSeq Size | 1760 bp |
RefSeq ORF | 960 bp |
Locus ID | 10170 |
UniProt ID | Q9BPW9 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Retinol metabolism |
Gene Summary | This gene encodes a member of the short-chain dehydrogenases/reductases (SDR) family. The encoded protein has been identified as a moonlighting protein based on its ability to perform mechanistically distinct functions. This protein demonstrates oxidoreductase activity toward hydroxysteroids and is able to convert 3-alpha-tetrahydroprogesterone to dihydroxyprogesterone and 3-alpha-androstanediol to dihydroxyprogesterone in the cytoplasm, and may additionally function as a transcriptional repressor in the nucleus. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jan 2014] Transcript Variant: This variant (3) differs in the 5' UTR, compared to variant 2. Variants 2-4 encode the same isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226895 | DHRS9 (Myc-DDK-tagged)-Human dehydrogenase/reductase (SDR family) member 9 (DHRS9), transcript variant 3 |
CNY 2,400.00 |
|
RC226895L3 | Lenti-ORF clone of DHRS9 (Myc-DDK-tagged)-Human dehydrogenase/reductase (SDR family) member 9 (DHRS9), transcript variant 3 |
CNY 5,890.00 |
|
RC226895L4 | Lenti-ORF clone of DHRS9 (mGFP-tagged)-Human dehydrogenase/reductase (SDR family) member 9 (DHRS9), transcript variant 3 |
CNY 5,890.00 |
|
RG226895 | DHRS9 (tGFP-tagged) - Human dehydrogenase/reductase (SDR family) member 9 (DHRS9), transcript variant 3 |
CNY 4,370.00 |