ETFBKMT (NM_001135864) Human Untagged Clone

CAT#: SC324865

METTL20 (untagged)-Human methyltransferase like 20 (METTL20), transcript variant 3



  "NM_001135864" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
METTL20 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C12orf72; ETFB-KMT; METTL20
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324865 representing NM_001135864.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTTTGAGTCTAGGTTGGAAAGCACACAGGAACCACTGTGGTCTCCTCTTGCAGGCTCTGCGAAGC
AGTGGTCTTCTCTTGTTTCCCTGTGGCCAGTGTCCCTGGAGAGGAGCTGGAAGCTTTTTGGACCCTGAG
ATAAAGGCTTTCCTGGAGGAGAACACTGAAGTCACCAGCAGTGGTAGCCTCACCCCTGAAATCCAGTTG
CGGCTTTTGACCCCCAGATGCAAATTCTGGTGGGAGAGAGCTGACCTGTGGCCCCACAGTGATCCTTAC
TGGGCAATCTACTGGCCAGGAGGCCAAGCCCTGTCTAGGTATCTTTTGGATAATCCTGATGTTGTCAGA
GGAAAATCTGTATTAGATCTTGGGAGTGGATGTGGAGCTACAGCTATTGCTGCTAAGATGAGTGGGGCA
TCAAGGATCTTGGCCAATGACATAGACCCTATTGCAGGAATGGCTATTACACTAAATTGTGAATTGAAC
AGACTGAATCCTTTTCCTATTTTAATCCAAAACATTTTGAATTTGGAACAAGATAAGTGGGACCTTGTT
GTTCTTGGCGATATGTTTTATGATGAAGACCTTGCAGATAGTCTTCATCAGTGGCTGAAGAAGTGCTTC
TGGACCTATAGAACTCGAGTACTGATTGGTGACCCTGGGCGGCCCCAGTTCAGTGGACACAGCATTCAG
CATCACCTGCACAAAGTGGTAGAATATTCACTTTTGGAGTCTACTAGGCAGGAAAACAGTGGACTGACA
ACAAGCACAGTGTGGGGTTTTCAGCCTTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135864
Insert Size 789 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135864.1
RefSeq Size 2103 bp
RefSeq ORF 789 bp
Locus ID 254013
UniProt ID Q8IXQ9
Protein Families Druggable Genome
MW 29.5 kDa
Gene Summary Protein-lysine methyltransferase that selectively trimethylates the flavoprotein ETFB in mitochondria (PubMed:25023281, PubMed:25416781). Thereby, may negatively regulate the function of ETFB in electron transfer from Acyl-CoA dehydrogenases to the main respiratory chain (PubMed:25416781).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (3) uses a different segment for its 5' UTR, compared to variant 1. Variants 1, 2, and 3 encode the same protein. Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...