KCTD1 (NM_001136205) Human Untagged Clone
CAT#: SC324858
KCTD1 (untagged)-Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1
CN¥ 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C18orf5 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC324858 representing NM_001136205.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCAAGACCTCTGATCACTAGATCCCCTGCATCTCCACTGAACAACCAAGGCATCCCTACTCCAGCA CAACTCACAAAATCCAATGCGCCTGTCCACATTGATGTGGGCGGCCACATGTACACCAGCAGCCTGGCC ACCCTCACCAAATACCCTGAATCCAGAATCGGAAGACTTTTTGATGGTACAGAGCCCATTGTTTTGGAC AGTCTCAAACAGCACTATTTCATTGACAGAGATGGACAGATGTTCAGATATATCTTGAATTTTCTACGA ACATCCAAACTCCTCATTCCTGATGATTTCAAGGACTACACTTTGTTATATGAAGAGGCAAAATATTTT CAGCTTCAGCCCATGTTGTTGGAGATGGAAAGATGGAAGCAGGACAGAGAAACTGGTCGATTTTCAAGG CCCTGTGAGTGCCTCGTCGTGCGTGTGGCCCCAGACCTCGGAGAAAGGATCACGCTAAGCGGTGACAAA TCCTTGATAGAAGAAGTATTTCCAGAGATCGGCGACGTGATGTGTAACTCTGTCAATGCAGGCTGGAAT CACGACTCGACGCACGTCATCAGGTTTCCACTAAATGGCTACTGTCACCTCAACTCAGTCCAGGTCCTC GAGAGGTTGCAGCAAAGAGGATTTGAAATCGTGGGCTCCTGTGGGGGAGGAGTAGACTCGTCCCAGTTC AGCGAATACGTCCTTCGGCGGGAACTGAGGCGGACGCCCCGTGTACCCTCCGTCATCCGGATAAAGCAA GAGCCTCTGGACTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001136205 |
Insert Size | 774 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001136205.2 |
RefSeq Size | 2174 bp |
RefSeq ORF | 774 bp |
Locus ID | 284252 |
UniProt ID | Q719H9 |
Protein Families | Ion Channels: Other |
MW | 29.4 kDa |
Gene Summary | This gene encodes a protein containing a BTB (Broad-complex, tramtrack and bric a brac), also known as a POZ (POxvirus and zinc finger) protein-protein interaction domain. The encoded protein negatively regulates the AP-2 family of transcription factors and the Wnt signaling pathway. A mechanism for the modulation of Wnt signaling has been proposed in which the encoded protein enhances ubiquitination and degradation of the beta-catenin protein. Mutations in this gene have been identified in Scalp-ear-nipple (SEN) syndrome. [provided by RefSeq, May 2017] Transcript Variant: This variant (1) differs in the 5' UTR, lacks a portion of the 5' coding region, and uses a downstream in-frame start codon, compared to variant 3. Variants 1, 2, 4 and 6 all encode the same isoform (a), which has a shorter N-terminus compared to isoform b. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC226740 | KCTD1 (Myc-DDK-tagged)-Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1 |
CN¥ 2,400.00 |
|
RC226740L3 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC226740L4 | Lenti ORF clone of Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1, mGFP tagged |
CN¥ 5,890.00 |
|
RG226740 | KCTD1 (tGFP-tagged) - Human potassium channel tetramerisation domain containing 1 (KCTD1), transcript variant 1 |
CN¥ 4,000.00 |