United States
Germany
Japan
United Kingdom
China
PNPLA4 (NM_001142389) Human Untagged Clone
CAT＃: SC324854
PNPLA4 (untagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DXS1283E; GS2; iPLA2eta |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC324854 representing NM_001142389.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCACATCAACCTATCATTTGCAGCGTGTGGATTTCTGGGCATTTACCACTTGGGGGCAGCATCT GCACTTTGCAGACATGGCAAAAAACTTGTGAAGGATGTCAAAGCCTTCGCTGGGGCGTCTGCGGGATCG TTGGTTGCTTCTGTTCTGCTAACAGCACCAGAAAAAATAGAGGAATGTAACCAATTTACCTACAAGTTT GCCGAAGAAATCAGAAGGCAGTCTTTCGGGGCAGTAACGCCCGGTTATGACTTCATGGCCCGACTAAGA AGTGGGATGGAGTCGATTCTTCCTCCCAGCGCTCACGAGCTGGCCCAGAACCGACTGCACGTATCCATC ACCAACGCCAAAACCAGAGAAAATCACTTAGTCTCCACTTTTTCCTCCAGGGAGGACCTCATTAAGGTC CTCCTAGCCAGCAGTTTTGTGCCCATTTATGCAGGACTGAAGCTAGTGGAATACAAAGGGCAGAAGTGG GTGGACGGAGGCCTCACCAACGCTCTTCCCATCCTGCCCGTCGGCCGGACAGTAACCATCTCCCCCTTC AGTGGACGACTGGACATCTCCCCGCAGGACAAAGGGCAGCTAGATCTGTATGTTAATATCGCCAAGCAG GATATCATGTTGTCCCTGGCAAACCTGGTGAGACTCAACCAAGCCCTTTTTCCCCCAAGCAAGAGGAAA ATGGAATCTTTGTATCAGTGTGGTTTTGATGACACTGTTAAGTTTTTACTTAAAGAAAATTGGTTTGAA TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001142389 |
| Insert Size | 762 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001142389.1 |
| RefSeq Size | 2752 bp |
| RefSeq ORF | 762 bp |
| Locus ID | 8228 |
| UniProt ID | P41247 |
| Protein Pathways | Retinol metabolism |
| MW | 28 kDa |
| Gene Summary | This gene encodes a member of the patatin-like family of phospholipases. The encoded enzyme has both triacylglycerol lipase and transacylase activities and may be involved in adipocyte triglyceride homeostasis. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome Y. [provided by RefSeq, Feb 2010] Transcript Variant: This variant (2) differs in the 5' UTR, compared to variant 1. Variants 1 and 2 encode the same isoform (1). Sequence Note: The RefSeq transcript and protein were derived from transcript and genomic sequence to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC226698 | PNPLA4 (Myc-DDK-tagged)-Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2 |
CNY 3,600.00 |
|
| RC226698L1 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
| RC226698L2 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC226698L3 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC226698L4 | Lenti ORF clone of Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG226698 | PNPLA4 (tGFP-tagged) - Human patatin-like phospholipase domain containing 4 (PNPLA4), transcript variant 2 |
CNY 4,370.00 |
