RNF185 (NM_001135824) Human Untagged Clone

CAT#: SC324773

RNF185 (untagged)-Human ring finger protein 185 (RNF185), transcript variant 2



  "NM_001135824" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-RNF185 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms BSK65-MONO1; BSK65-MONO2; BSK65-PANC1; BSK65-PANC2; BSK65-TEST1; BSK65-TEST2; BSK65-TEST3; FLJ38628; ring finger protein 185
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC324773 representing NM_001135824.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCAAGCAAGGGGCCCTCGGCCTCTGCATCTCCTGAGAACTCCAGTGCAGGGGGGCCCAGTGGGAGC
AGCAATGGCGCTGGCGAGAGCGGAGGGCAGGACAGCACTTTCGAGTGCAACATCTGCTTGGACACAGCC
AAGGATGCCGTCATCAGCCTGTGTGGCCACCTCTTCTGTTGGCCGTGTTTACATCAGTGGTTGGAGACC
AGACCTAACAGACAGGTGTGTCCTGTTTGCAAAGCTGGCATCAGCCGAGACAAGGTCATCCCCCTCTAT
GGAAGGGGCAGCACTGGGCAACAGGACCCCAGAGAGAAGACCCCTCCTCGTCCTCAAGGACAGAGGCCA
GAGCCGGAGAATAGAGGGGGATTTCAAGGATTTGGATTTGGAGATGGTGGCTTCCAGATGTCTTTTGGA
ATTGGGGCATTTCCCTTTGGGATATTTGCCACAGCATTTAATATAAATGATGGGCGGCCTCCTCCAGCT
GTCCCTGGGACACCCCAGTATGTGGACGAGCAGTTCCTGTCACGCCTCTTCCTATTTGTGGCCCTGGTG
ATCATGTTCTGGCTCCTGATTGCCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001135824
Insert Size 579 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001135824.1
RefSeq Size 2635 bp
RefSeq ORF 579 bp
Locus ID 91445
Protein Families Druggable Genome, Transmembrane
MW 20.5 kDa
Gene Summary E3 ubiquitin-protein ligase that regulates selective mitochondrial autophagy by mediating 'Lys-63'-linked polyubiquitination of BNIP1 (PubMed:21931693). Acts in the endoplasmic reticulum (ER)-associated degradation (ERAD) pathway, which targets misfolded proteins that accumulate in the endoplasmic reticulum (ER) for ubiquitination and subsequent proteasome-mediated degradation (PubMed:27485036). Protects cells from ER stress-induced apoptosis (PubMed:27485036). Responsible for the cotranslational ubiquitination and degradation of CFTR in the ERAD pathway (PubMed:24019521). Preferentially associates with the E2 enzymes UBE2J1 and UBE2J2 (PubMed:24019521).[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (2) has a split exon at the 3' end compared to transcript variant 1, however, both variants encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...