United States
Germany
Japan
United Kingdom
China
Xg blood group (XG) (NM_001141920) Human Untagged Clone
CAT＃: SC324765
XG (untagged)-Human Xg blood group (XG), transcript variant 3
CN¥ 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PBDX |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_001141920, the custom clone sequence may differ by one or more nucleotides
ATGGAGAGCTGGTGGGGACTTCCCTGTCTTGCGTTCCTGTGTTTTCTAATGCACGCCCGA GGTCAAAGAGACTTTGATTTGGCAGATGCCCTTGATGACCCTGAACCCACCAAGAAGCCA AACTCAGATATCTACCCAAAGCCAAAACCACCTTACTACCCACAGCCCGAGAATCCCGAC AGCGGTGGAAATATCTACCCAAGGCCAAAGCCACGCCCTCAACCCCAGCCTGGCAATTCC GGCAACAGTGGAGGTAGTTACTTCAATGATGTGGACCGTGATGACGGACGCTACCCGCCC AGGCCCAGGCCACGGCCGCCTGCAGGAGGTGGCGGCGGTGGCTACTCCAGTTATGGCAAC TCCGACAACACGCACGGTGGAGATCACCATTCAACGTATGGCAATCCAGAAGGCAATATG GTAGCAAAAATCGTGTCTCCCATCGTATCCGTGGTGGTGGTGACACTGCTGGGAGCAGCA GCCAGTTATTTCAAACTAAACAATAGGAGAAATTGTTTCAGGACCCATGAACCAGAAAAT GTC |
| Restriction Sites | Please inquire |
| ACCN | NM_001141920 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001141920.1, NP_001135392.1 |
| RefSeq Size | 2902 bp |
| RefSeq ORF | 546 bp |
| Locus ID | 7499 |
| UniProt ID | P55808 |
| Protein Families | Transmembrane |
| Gene Summary | This gene encodes the XG blood group antigen, and is located at the pseudoautosomal boundary on the short (p) arm of chromosome X. The three 5' exons reside in the pseudoautosomal region and the remaining exons within the X-specific end. A truncated copy of this gene is found on the Y chromosome at the pseudoautosomal boundary. It is transcribed, but not expected to make a Y-chromosome specific gene product. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Nov 2008] Transcript Variant: This variant (3) uses an alternate donor splice site at one of the coding exons compared to transcript variant 1, resulting in an isoform (3) containing one additional aa compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no quality transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. Sequence Note: This RefSeq record represents the XG*001.1.1 allele. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC227042 | XG (Myc-DDK-tagged)-Human Xg blood group (XG), transcript variant 3 |
CN¥ 3,990.00 |
|
| RC227042L3 | Lenti-ORF clone of XG (Myc-DDK-tagged)-Human Xg blood group (XG), transcript variant 3 |
CN¥ 5,890.00 |
|
| RC227042L4 | Lenti-ORF clone of XG (mGFP-tagged)-Human Xg blood group (XG), transcript variant 3 |
CN¥ 5,890.00 |
|
| RG227042 | XG (tGFP-tagged) - Human Xg blood group (XG), transcript variant 3 |
CN¥ 4,370.00 |
其它Xg blood group产品
