LSM5 (NM_001139499) Human Untagged Clone
CAT#: SC324689
LSM5 (untagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | YER146W |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001139499, the custom clone sequence may differ by one or more nucleotides
ATGAAGAGTGATAAGGAAATTGTTGGTACTCTTCTAGGATTTGATGACTTTGTCAATATG GTACTGGAAGATGTCACTGAGTTTGAAATCACACCAGAAGGAAGAAGGATTACTAAATTA GATCAGATTTTGCTAAATGGAAATAATATAACAATGCTGGTTCCTGGAGGAGAAGGACCT GAAGTG |
Restriction Sites | Please inquire |
ACCN | NM_001139499 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001139499.1, NP_001132971.1 |
RefSeq Size | 2451 bp |
RefSeq ORF | 189 bp |
Locus ID | 23658 |
UniProt ID | Q9Y4Y9 |
Protein Families | Stem cell - Pluripotency |
Protein Pathways | RNA degradation, Spliceosome |
Gene Summary | Sm-like proteins were identified in a variety of organisms based on sequence homology with the Sm protein family (see SNRPD2; MIM 601061). Sm-like proteins contain the Sm sequence motif, which consists of 2 regions separated by a linker of variable length that folds as a loop. The Sm-like proteins are thought to form a stable heteromer present in tri-snRNP particles, which are important for pre-mRNA splicing.[supplied by OMIM, Apr 2004] Transcript Variant: This variant (3) differs in the 5' UTR, lacks a segment of the 5' coding region, and uses a downstream translation initiation codon, compared to variant 1. The resulting isoform (b) is shorter at the N-terminus, compared to isoform a. Both variants 2 and 3 encode the same isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The extent of this transcript is supported by transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC227982 | LSM5 (Myc-DDK-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
CNY 3,990.00 |
|
RC227982L3 | Lenti-ORF clone of LSM5 (Myc-DDK-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
CNY 5,890.00 |
|
RC227982L4 | Lenti-ORF clone of LSM5 (mGFP-tagged)-Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
CNY 5,890.00 |
|
RG227982 | LSM5 (tGFP-tagged) - Human LSM5 homolog, U6 small nuclear RNA associated (S. cerevisiae) (LSM5), transcript variant 3 |
CNY 4,370.00 |