FPR1 (NM_002029) Human Untagged Clone
CAT#: SC324418
FPR1 (untagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2
CNY 5,488.00
Cited in 4 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FMLP; FPR |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002029.3
AGAGCCTGAGTCACTCTCCCCAGGAGACCCAGACCTAGAACTACCCAGAGCAAGACCACA
GCTGGTGAACAGTCCAGGAGCAGACAAGATGGAGACAAATTCCTCTCTCCCCACGAACAT CTCTGGAGGGACACCTGCTGTATCTGCTGGCTATCTCTTCCTGGATATCATCACTTATCT GGTATTTGCAGTCACCTTTGTCCTCGGGGTCCTGGGCAACGGGCTTGTGATCTGGGTGGC TGGATTCCGGATGACACACACAGTCACCACCATCAGTTACCTGAACCTGGCCGTGGCTGA CTTCTGTTTCACCTCCACTTTGCCATTCTTCATGGTCAGGAAGGCCATGGGAGGACATTG GCCTTTCGGCTGGTTCCTGTGCAAATTCGTCTTTACCATAGTGGACATCAACTTGTTCGG AAGTGTCTTCCTGATCGCCCTCATTGCTCTGGACCGCTGTGTTTGCGTCCTGCATCCAGT CTGGACCCAGAACCACCGCACCGTGAGCCTGGCCAAGAAGGTGATCATTGGGCCCTGGGT GATGGCTCTGCTCCTCACATTGCCAGTTATCATTCGTGTGACTACAGTACCTGGTAAAAC GGGGACAGTAGCCTGCACTTTTAACTTTTCGCCCTGGACCAACGACCCTAAAGAGAGGAT AAATGTGGCCGTTGCCATGTTGACGGTGAGAGGCATCATCCGGTTCATCATTGGCTTCAG CGCACCCATGTCCATCGTTGCTGTCAGTTATGGGCTTATTGCCACCAAGATCCACAAGCA AGGCTTGATTAAGTCCAGTCGTCCCTTACGGGTCCTCTCCTTTGTCGCAGCAGCCTTTTT TCTCTGCTGGTCCCCATATCAGGTGGTGGCCCTTATAGCCACAGTCAGAATCCGTGAGTT ATTGCAAGGCATGTACAAAGAAATTGGTATTGCAGTGGATGTGACAAGTGCCCTGGCCTT CTTCAACAGCTGCCTCAACCCCATGCTCTATGTCTTCATGGGCCAGGACTTCCGGGAGAG GCTGATCCACGCCCTTCCCGCCAGTCTGGAGAGGGCCCTGACCGAGGACTCAACCCAAAC TAGTGACACAGCTACCAATTCTACTTTACCTTCTGCAGAGGTGGAGTTACAGGCAAAGTG AGGAGGGAGCTGGGGGACACTTTCGAGCTCCCAGCTCCAGCTTCGTCTCACCTTGAGTTA GGCTGAGCCACAGGCATTTCCTGCTTATTTTAGGATTACCCACTCATCAGAAAAAAAAAA AAAAGCCTTTGTGTCCCCTGATTTGGGGAGAATAAACAGATATGAGTCCAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002029 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002029.3, NP_002020.1 |
RefSeq Size | 1334 bp |
RefSeq ORF | 1053 bp |
Locus ID | 2357 |
UniProt ID | P21462 |
Domains | 7tm_1 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Protein Pathways | Neuroactive ligand-receptor interaction |
Gene Summary | This gene encodes a G protein-coupled receptor of mammalian phagocytic cells that is a member of the G-protein coupled receptor 1 family. The protein mediates the response of phagocytic cells to invasion of the host by microorganisms and is important in host defense and inflammation.[provided by RefSeq, Jul 2010] Transcript Variant: This variant (2) differs in the 5' UTR compared to variant 1. Both variants 1 and 2 encode the same protein. |
Citations (4)
The use of this cDNA Clones has been cited in the following citations: |
---|
Randialic acid B and tomentosolic acid block formyl peptide receptor 1 in human neutrophils and attenuate psoriasis-like inflammation in vivo
,Korinek, M;Hsieh, PS;Chen, YL;Hsieh, PW;Chang, SH;Wu, YH;Hwang, TL;,
Biochemical pharmacology
,PubMed ID 33964283
[FPR1]
|
Garcinia Multiflora Inhibits FPR1-Mediated Neutrophil Activation and Protects Against Acute Lung Injury
,Tsai, YF;Yang, SC;Chang, WY;Chen, JJ;Chen, CY;Chang, SH;Hwang, TL;,
Cell. Physiol. Biochem.
,PubMed ID 30562761
[FPR1]
|
Honokiol suppresses formyl peptide-induced human neutrophil activation by blocking formyl peptide receptor 1
,Liu, FC;Yu, HP;Syu, YT;Fang, JY;Lin, CF;Chang, SH;Lee, YT;Hwang, TL;,
Sci Rep
,PubMed ID 28751674
[FPR1]
|
Dipeptide HCH6-1 inhibits neutrophil activation and protects against acute lung injury by blocking FPR1
,Yang, SC;Chang, SH;Hsieh, PW;Huang, YT;Ho, CM;Tsai, YF;Hwang, TL;,
Free Radic. Biol. Med
,PubMed ID 28232203
[FPR1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202745 | FPR1 (Myc-DDK-tagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2 |
CNY 5,488.00 |
|
RC202745L1 | Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC202745L2 | Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC202745L3 | Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC202745L4 | Lenti ORF clone of Human formyl peptide receptor 1 (FPR1), transcript variant 2, mGFP tagged |
CNY 7,888.00 |
|
RG202745 | FPR1 (tGFP-tagged) - Human formyl peptide receptor 1 (FPR1), transcript variant 2 |
CNY 7,088.00 |
|
SC118857 | FPR1 (untagged)-Human formyl peptide receptor 1 (FPR1), transcript variant 2 |
CNY 5,488.00 |