United States
Germany
Japan
United Kingdom
China
ATP6V0B (NM_001039457) Human Untagged Clone
CAT＃: SC324389
ATP6V0B (untagged)-Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ATP6F; HATPL; VMA16 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001039457.1
GTGGACGCTGGGACGCGTTTGTAGCTCCGGCCCCGCCGTTCCGACCCCCGCCGCCGTCGC
CGCCATGACGGGGCTAGCACTGCTCTACTCCGGGGTCTTCGTGGCCTTCTGGGCCTGCGC GCTGGCCGTGGGAGTCTGCTACACCATTTTTGATTTGGGCTTCCGCTTTGATGTGGCATG GTTCCTGACGGAGACTTCGCCCTTCATGTGGTCCAACCTGGGCATTGGCCTAGCTATCTC CCTGTCTGTGGTTGGGGCAGCCTGGGGCATCTATATTACCGGCTCCTCCATCATTGGTGG AGGAGTGAAGGCCCCCAGGATCAAGACCAAGAACCTGGTCAGCATCATCTTCTGTGAGGC TGTGGCCATCTACGGCATCATCATGGCAATTGTCATTAGCAACATGGCTGAGCCTTTCAG TGCCACAGACCCCAAGGCCATCGGCCATCGGAACTACCATGCAGGCTACTCCATGTTTGG GGCTGGCCTCACCGTAGGCCTGTCTAACCTCTTCTGTGGAGTCTGCGTGGGCATCGTGGG CAGTGGGGCTGCCCTGGCCGATGCTCAGAACCCCAGCCTCTTTGTAAAGATTCTCATCGT GGAGATCTTTGGCAGCGCCATTGGCCTCTTTGGGGTCATCGTCGCAATTCTTCAGACCTC CAGAGTGAAGATGGGTGACTAGATGATATGTGTGGGTGGGGCCGTGCCTCACTTTTATTT ATTGCTGGTTTTCCTGGGACAGCTGGAGCTGTGTCCCTTAGCCTTTCAGAGGCTTGGTGT TCAGGGCCCTCCCTGCACTCCCCTCTTGCTGCGTGTTGATTTGGAGGCACTGCAGTCCAG GCCGAGTCCTCAGTGCGGGGAGCAGGCTGCTGCTGCTGACTCTGTGCAGCTGCGCACCTG TGTCCCCCACCTCCACCCTCAACCCATCTTCCTAGTGTTTGTGAAATAAACTTGGTATTT GTCTGGGTCAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001039457 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001039457.1, NP_001034546.1 |
| RefSeq Size | 979 bp |
| RefSeq ORF | 477 bp |
| Locus ID | 533 |
| UniProt ID | Q99437 |
| Protein Families | Transmembrane |
| Protein Pathways | Epithelial cell signaling in Helicobacter pylori infection, Lysosome, Metabolic pathways, Oxidative phosphorylation, Vibrio cholerae infection |
| Gene Summary | This gene encodes a portion of the V0 domain of vacuolar ATPase (V-ATPase), a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. Activity of this enzyme is necessary for such varied processes as protein sorting, zymogen activation, receptor-mediated endocytosis, and synaptic vesicle proton gradient generation. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014] Transcript Variant: This variant (2) lacks an alternate in-frame in the 5' coding region and uses a downstream start codon, compared to variant 1. The encoded isoform (2) has a shorter N-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201396 | ATP6V0B (Myc-DDK-tagged)-Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 2 |
CNY 2,400.00 |
|
| RC201396L3 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC201396L4 | Lenti ORF clone of Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG201396 | ATP6V0B (tGFP-tagged) - Human ATPase, H+ transporting, lysosomal 21kDa, V0 subunit b (ATP6V0B), transcript variant 2 |
CNY 4,000.00 |
其它ATP6V0B产品
