United States
Germany
Japan
United Kingdom
China
DDIT3 (NM_004083) Human Untagged Clone
CAT＃: SC324377
DDIT3 (untagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5
CNY 2,400.00
CNY 2,950.00
| Cited in 5 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AltDDIT3; C/EBPzeta; CEBPZ; CHOP; CHOP-10; CHOP10; GADD153 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004083.4
GAGAGAGAGAGACTTAAGTCTAAGGCACTGAGCGTATCATGTTAAAGATGAGCGGGTGGC
AGCGACAGAGCCAAAATCAGAGCTGGAACCTGAGGAGAGAGTGTTCAAGAAGGAAGTGTA TCTTCATACATCACCACACCTGAAAGCAGATGTGCTTTTCCAGACTGATCCAACTGCAGA GATGGCAGCTGAGTCATTGCCTTTCTCCTTTGGGACACTGTCCAGCTGGGAGCTGGAAGC CTGGTATGAGGACCTGCAAGAGGTCCTGTCTTCAGATGAAAATGGGGGTACCTATGTTTC ACCTCCTGGAAATGAAGAGGAAGAATCAAAAATCTTCACCACTCTTGACCCTGCTTCTCT GGCTTGGCTGACTGAGGAGGAGCCAGAACCAGCAGAGGTCACAAGCACCTCCCAGAGCCC TCACTCTCCAGATTCCAGTCAGAGCTCCCTGGCTCAGGAGGAAGAGGAGGAAGACCAAGG GAGAACCAGGAAACGGAAACAGAGTGGTCATTCCCCAGCCCGGGCTGGAAAGCAGCGCAT GAAGGAGAAAGAACAGGAGAATGAAAGGAAAGTGGCACAGCTAGCTGAAGAGAATGAACG GCTCAAGCAGGAAATCGAGCGCCTGACCAGGGAAGTAGAGGCGACTCGCCGAGCTCTGAT TGACCGAATGGTGAATCTGCACCAAGCATGAACAATTGGGAGCATCAGTCCCCCACTTGG GCCACACTACCCACCTTTCCCAGAAGTGGCTACTGACTACCCTCTCACTAGTGCCAATGA TGTGACCCTCAATCCCACATACGCAGGGGGAAGGCTTGGAGTAGACAAAAGGAAAGGTCT CAGCTTGTATATAGAGATTGTACATTTATTTATTACTGTCCCTATCTATTAAAGTGACTT TCTATGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004083 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004083.4, NP_004074.2 |
| RefSeq Size | 927 bp |
| RefSeq ORF | 510 bp |
| Locus ID | 1649 |
| UniProt ID | P35638 |
| Domains | BRLZ |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | MAPK signaling pathway |
| Gene Summary | This gene encodes a member of the CCAAT/enhancer-binding protein (C/EBP) family of transcription factors. The protein functions as a dominant-negative inhibitor by forming heterodimers with other C/EBP members, such as C/EBP and LAP (liver activator protein), and preventing their DNA binding activity. The protein is implicated in adipogenesis and erythropoiesis, is activated by endoplasmic reticulum stress, and promotes apoptosis. Fusion of this gene and FUS on chromosome 16 or EWSR1 on chromosome 22 induced by translocation generates chimeric proteins in myxoid liposarcomas or Ewing sarcoma. Multiple alternatively spliced transcript variants encoding two isoforms with different length have been identified. [provided by RefSeq, Aug 2010] Transcript Variant: This variant (5) lacks an internal segment in the 5' region, resulting in a downstream AUG start codon, as compared to variant 1. The resulting isoform (2) is shorter at the N-terminus, as compared to isoform 1. |
Citations (5)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Endoplasmic reticulum stress induced by tunicamycin increases resistin messenger ribonucleic acid through the pancreatic endoplasmic reticulum eukaryotic initiation factor 2α kinase–activating transcription factor 4–CAAT/enhancer binding protein‐α homologous protein pathway in THP‐1 human monocytes
,null,
Journal of Diabetes Investigation
,PubMed ID 27330716
[DDIT3]
|
|
Mechanistic Elucidation of the Antitumor Properties of Withaferin A in Breast Cancer
,Nagalingam, A;Kuppusamy, P;Singh, SV;Sharma, D;Saxena, NK;,
Cancer Res. April 2014
,PubMed ID 24732433
[DDIT3]
|
|
C/EBP homologous protein drives pro-catabolic responses in chondrocytes
,Husa, M;Petursson, F;Lotz, M;Terkeltaub, R;Liu-Bryan, R;,
Arthritis Res. Ther. Dec 2013.
,PubMed ID 24351550
[DDIT3]
|
|
Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress
,K H Tay, L Jin, H-Y Tseng, C C Jiang, Y Ye, R F Thorne, T Liu, S T Guo, N M Verrills, P Hersey & X D Zhang,
Cell Death and Disease 3, e337 doi:10.1038/cddis.2012.79
[DDIT3]
|
|
Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress
,null,
Cell Death & Disease
,PubMed ID 22739989
[DDIT3]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201301 | DDIT3 (Myc-DDK-tagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 |
CNY 2,400.00 |
|
| RC201301L1 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201301L2 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, mGFP tagged |
CNY 5,890.00 |
|
| RC201301L3 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201301L4 | Lenti ORF clone of Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5, mGFP tagged |
CNY 4,800.00 |
|
| RG201301 | DDIT3 (tGFP-tagged) - Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 |
CNY 4,000.00 |
|
| SC117581 | DDIT3 (untagged)-Human DNA-damage-inducible transcript 3 (DDIT3), transcript variant 5 |
CNY 2,400.00 |
