GPRC5C (NM_022036) Human Untagged Clone
CAT#: SC324348
GPRC5C (untagged)-Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1
CNY 3,656.00
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | RAIG-3; RAIG3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_022036, the custom clone sequence may differ by one or more nucleotides
ATGCGGGGGCGTGGCAGTCAACAGCAACAACCCACACGCCGGCAGGGCCAGAAACTCCCATCTCCCTCAC CAGCCGGAAAGTACGAGTCGGCTCAGCCTGGAGGGACCCAACCAGAGCCTGGCCTGGGAGCCAGGATGGC CATCCACAAAGCCTTGGTGATGTGCCTGGGACTGCCTCTCTTCCTGTTCCCAGGGGCCTGGGCCCAGGGC CATGTCCCACCCGGCTGCAGCCAAGGCCTCAACCCCCTGTACTACAACCTGTGTGACCGCTCTGGGGCGT GGGGCATCGTCCTGGAGGCCGTGGCTGGGGCGGGCATTGTCACCACGTTTGTGCTCACCATCATCCTGGT GGCCAGCCTCCCCTTTGTGCAGGACACCAAGAAACGGAGCCTGCTGGGGACCCAGGTATTCTTCCTTCTG GGGACCCTGGGCCTCTTCTGCCTCGTGTTTGCCTGTGTGGTGAAGCCCGACTTCTCCACCTGTGCCTCTC GGCGCTTCCTCTTTGGGGTTCTGTTCGCCATCTGCTTCTCTTGTCTGGCGGCTCACGTCTTTGCCCTCAA CTTCCTGGCCCGGAAGAACCACGGGCCCCGGGGCTGGGTGATCTTCACTGTGGCTCTGCTGCTGACCCTG GTAGAGGTCATCATCAATACAGAGTGGCTGATCATCACCCTGGTTCGGGGCAGTGGCGAGGGCGGCCCTC AGGGCAACAGCAGCGCAGGCTGGGCCGTGGCCTCCCCCTGTGCCATCGCCAACATGGACTTTGTCATGGC ACTCATCTACGTCATGCTGCTGCTGCTGGGTGCCTTCCTGGGGGCCTGGCCCGCCCTGTGTGGCCGCTAC AAGCGCTGGCGTAAGCATGGGGTCTTTGTGCTCCTCACCACAGCCACCTCCGTTGCCATATGGGTGGTGT GGATCGTCATGTATACTTACGGCAACAAGCAGCACAACAGTCCCACCTGGGATGACCCCACGCTGGCCAT CGCCCTCGCCGCCAATGCCTGGGCCTTCGTCCTCTTCTACGTCATCCCCGAGGTCTCCCAGGTGACCAAG TCCAGCCCAGAGCAAAGCTACCAGGGGGACATGTACCCCACCCGGGGCGTGGGCTATGAGACCATCCTGA AAGAGCAGAAGGGTCAGAGCATGTTCGTGGAGAACAAGGCCTTTTCCATGGATGAGCCGGTTGCAGCTAA GAGGCCGGTGTCACCATACAGCGGGTACAATGGGCAGCTGCTGACCAGTGTGTACCAGCCCACTGAGATG GCCCTGATGCACAAAGTTCCGTCCGAAGGAGCTTACGACATCATCCTCCCACGGGCCACCGCCAACAGCC AGGTGATGGGCAGTGCCAACTCGACCCTGCGGGCTGAAGACATGTACTCGGCCCAGAGCCACCAGGCGGC CACACCGCCGAAAGACGGCAAGAACTCTCAGGTCTTTAGAAACCCCTACGTGTGGGACTGA |
Restriction Sites | Please inquire |
ACCN | NM_022036 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_022036.2, NP_071319.2 |
RefSeq Size | 2389 bp |
RefSeq ORF | 1461 bp |
Locus ID | 55890 |
UniProt ID | Q9NQ84 |
Domains | 7tm_3 |
Protein Families | Druggable Genome, GPCR, Transmembrane |
Gene Summary | The protein encoded by this gene is a member of the type 3 G protein-coupled receptor family. Members of this superfamily are characterized by a signature 7-transmembrane domain motif. The specific function of this protein is unknown; however, this protein may mediate the cellular effects of retinoic acid on the G protein signal transduction cascade. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) encodes isoform a. Variants 1, 2 and 4 encode isoform a. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211081 | GPRC5C (Myc-DDK-tagged)-Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1 |
CNY 3,656.00 |
|
RC211081L1 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC211081L2 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC211081L3 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC211081L4 | Lenti ORF clone of Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG211081 | GPRC5C (tGFP-tagged) - Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1 |
CNY 5,256.00 |
|
SC110534 | GPRC5C (untagged)-Human G protein-coupled receptor, family C, group 5, member C (GPRC5C), transcript variant 1 |
CNY 3,656.00 |