United States
Germany
Japan
United Kingdom
China
S6K1 (RPS6KB1) (NM_003161) Human Untagged Clone
CAT＃: SC323348
RPS6KB1 (untagged)-Kinase deficient mutant (K123M) of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1)
CNY 8,460.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | p70 S6KA; p70(S6K)-alpha; p70-alpha; p70-S6K; PS6K; S6K; S6K-beta-1; S6K1; STK14A |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene ORF sequence for NM_003161 edited
ATGAGGCGACGAAGGAGGCGGGACGGCTTTTACCCAGCCCCGGACTTCCGAGACAGGGAA GCTGAGGACATGGCAGGAGTGTTTGACATAGACCTGGACCAGCCAGAGGACGCGGGCTCT GAGGATGAGCTGGAGGAGGGGGGTCAGTTAAATGAAAGCATGGACCATGGGGGAGTTGGA CCATATGAACTTGGCATGGAACATTGTGAGAAATTTGAAATCTCAGAAACTAGTGTGAAC AGAGGGCCAGAAAAAATCAGACCAGAATGTTTTGAGCTACTTCGGGTACTTGGTAAAGGG GGCTATGGAAAGGTTTTTCAAGTACGAAAAGTAACAGGAGCAAATACTGGGAAAATATTT GCCATGATGGTGCTTAAAAAGGCAATGATAGTAAGAAATGCTAAAGATACAGCTCATACA AAAGCAGAACGGAATATTCTGGAGGAAGTAAAGCATCCCTTCATCGTGGATTTAATTTAT GCCTTTCAGACTGGTGGAAAACTCTACCTCATCCTTGAGTATCTCAGTGGAGGAGAACTA TTTATGCAGTTAGAAAGAGAGGGAATATTTATGGAAGACACTGCCTGCTTTTACTTGGCA GAAATCTCCATGGCTTTGGGGCATTTACATCAAAAGGGGATCATCTACAGAGACCTGAAG CCGGAGAATATCATGCTTAATCACCAAGGTCATGTGAAACTAACAGACTTTGGACTATGC AAAGAATCTATTCATGATGGAACAGTCACACACACATTTTGTGGAACAATAGAATACATG GCCCCTGAAATCTTGATGAGAAGTGGCCACAATCGTGCTGTGGATTGGTGGAGTTTGGGA GCATTAATGTATGACATGCTGACTGGAGCACCCCCATTCACTGGGGAGAATAGAAAGAAA ACAATTGACAAAATCCTCAAATGTAAACTCAATTTGCCTCCCTACCTCACACAAGAAGCC AGAGATCTGCTTAAAAAGCTGCTGAAAAGAAATGCTGCTTCTCGTCTGGGAGCTGGTCCT GGGGACGCTGGAGAAGTTCAAGCTCATCCATTCTTTAGACACATTAACTGGGAAGAACTT CTGGCTCGAAAGGTGGAGCCCCCCTTTAAACCTCTGTTGCAATCTGAAGAGGATGTAAGT CAGTTTGATTCCAAGTTTACACGTCAGACACCTGTCGACAGCCCAGATGACTCAACTCTC AGTGAAAGTGCCAATCAGGTCTTTCTGGGTTTTACATATGTGGCTCCATCTGTACTTGAA AGTGTGAAAGAAAAGTTTTCCTTTGAACCAAAAATCCGATCACCTCGAAGATTTATTGGC AGCCCACGAACACCTGTCAGCCCAGTCAAATTTTCTCCTGGGGATTTCTGGGGAAGAGGT GCTTCGGCCAGCACAGCAAATCCTCAGACACCTGTGGAATACCCAATGGAAACAAGTGGC ATAGAGCAGATGGATGTGACAATGAGTGGGGAAGCATCGGCACCACTTCCAATACGACAG CCGAACTCTGGGCCATACAAAAAACAAGCTTTTCCCATGATCTCCAAACGGCCAGAGCAC CTGCGTATGAATCTATGA |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_003161 |
| Insert Size | 1578 bp |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_003161.3 |
| RefSeq Size | 5368 bp |
| RefSeq ORF | 1578 bp |
| Locus ID | 6198 |
| UniProt ID | P23443 |
| Domains | pkinase, S_TK_X, TyrKc, S_TKc |
| Protein Families | Druggable Genome, Protein Kinase |
| Protein Pathways | Acute myeloid leukemia, ErbB signaling pathway, Fc gamma R-mediated phagocytosis, Insulin signaling pathway, mTOR signaling pathway, TGF-beta signaling pathway |
| MW | 59.1 kDa |
| Gene Summary | This gene encodes a member of the ribosomal S6 kinase family of serine/threonine kinases. The encoded protein responds to mTOR (mammalian target of rapamycin) signaling to promote protein synthesis, cell growth, and cell proliferation. Activity of this gene has been associated with human cancer. Alternatively spliced transcript variants have been observed. The use of alternative translation start sites results in isoforms with longer or shorter N-termini which may differ in their subcellular localizations. There are two pseudogenes for this gene on chromosome 17. [provided by RefSeq, Jan 2013] Transcript Variant: This variant (1) can initiate translation from two alternate in-frame AUG start codons. The isoform represented in this RefSeq (a, also known as p85 or alpha I) is derived from the first AUG start codon, and is the longest isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217324 | RPS6KB1 (Myc-DDK-tagged)-Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1) |
CNY 5,864.00 |
|
| RC217324L1 | Lenti ORF clone of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), Myc-DDK-tagged |
CNY 8,264.00 |
|
| RC217324L2 | Lenti ORF clone of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), mGFP tagged |
CNY 8,264.00 |
|
| RC217324L3 | Lenti ORF clone of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), Myc-DDK-tagged |
CNY 8,264.00 |
|
| RC217324L4 | Lenti ORF clone of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1), mGFP tagged |
CNY 8,264.00 |
|
| RG217324 | RPS6KB1 (tGFP-tagged) - Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1) |
CNY 7,464.00 |
|
| SC105680 | RPS6KB1 (untagged)-Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1) |
CNY 5,872.00 |
|
| SC323401 | RPS6KB1 (untagged)-Kinase deficient mutant (K123M) of Human ribosomal protein S6 kinase, 70kDa, polypeptide 1 (RPS6KB1) |
CNY 5,872.00 |
