SHC (SHC1) (NM_001130041) Human Untagged Clone
CAT#: SC323089
SHC1 (untagged)-Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 4
CN¥ 7,220.00
Cited in 1 publication. |
Product images

CN¥ 1,999.00
CN¥ 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | SHC; SHCA |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001130041, the custom clone sequence may differ by one or more nucleotides
ATGAACAAGCTGAGTGGAGGCGGCGGGCGCAGGACTCGGGTGGAAGGGGGCCAGCTTGGG GGCGAGGAGTGGACCCGCCACGGGAGCTTTGTCAATAAGCCCACGCGGGGCTGGCTGCAT CCCAACGACAAAGTCATGGGACCCGGGGTTTCCTACTTGGTTCGGTACATGGGTTGTGTG GAGGTCCTCCAGTCAATGCGTGCCCTGGACTTCAACACCCGGACTCAGGTCACCAGGGAG GCCATCAGTCTGGTGTGTGAGGCTGTGCCGGGTGCTAAGGGGGCGACAAGGAGGAGAAAG CCCTGTAGCCGCCCGCTCAGCTCTATCCTGGGGAGGAGTAACCTGAAATTTGCTGGAATG CCAATCACTCTCACCGTCTCCACCAGCAGCCTCAACCTCATGGCCGCAGACTGCAAACAG ATCATCGCCAACCACCACATGCAATCTATCTCATTTGCATCCGGCGGGGATCCGGACACA GCCGAGTATGTCGCCTATGTTGCCAAAGACCCTGTGAATCAGAGAGCCTGCCACATTCTG GAGTGTCCCGAAGGGCTTGCCCAGGATGTCATCAGCACCATTGGCCAGGCCTTCGAGTTG CGCTTCAAACAATACCTCAGGAACCCACCCAAACTGGTCACCCCTCATGACAGGATGGCT GGCTTTGATGGCTCAGCATGGGATGAGGAGGAGGAAGAGCCACCTGACCATCAGTACTAT AATGACTTCCCGGGGAAGGAACCCCCCTTGGGGGGGGTGGTAGACATGAGGCTTCGGGAA GGAGCCGCTCCAGGGGCTGCTCGACCCACTGCACCCAATGCCCAGACCCCCAGCCACTTG GGAGCTACATTGCCTGTAGGACAGCCTGTTGGGGGAGATCCAGAAGTCCGCAAACAGATG CCACCTCCACCACCCTGTCCAGGCAGAGAGCTTTTTGATGATCCCTCCTATGTCAACGTC CAGAACCTAGACAAGGCCCGGCAAGCAGTGGGTGGTGCTGGGCCCCCCAATCCTGCTATC AATGGCAGTGCACCCCGGGACCTGTTTGACATGAAGCCCTTCGAAGATGCTCTTCGCGTG CCTCCACCTCCCCAGTCGGTGTCCATGGCTGAGCAGCTCCGAGGGGAGCCCTGGTTCCAT GGGAAGCTGAGCCGGCGGGAGGCTGAGGCACTGCTGCAGCTCAATGGGGACTTCCTGGTA CGGGAGAGCACGACCACACCTGGCCAGTATGTGCTCACTGGCTTGCAGAGTGGGCAGCCT AAGCATTTGCTACTGGTGGACCCTGAGGGTGTGGTTCGGACTAAGGATCACCGCTTTGAA AGTGTCAGTCACCTTATCAGCTACCACATGGACAATCACTTGCCCATCATCTCTGCGGGC AGCGAACTGTGTCTACAGCAACCTGTGGAGCGGAAACTG |
Restriction Sites | Please inquire |
ACCN | NM_001130041 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001130041.1, NP_001123513.1 |
RefSeq Size | 3192 bp |
RefSeq ORF | 1422 bp |
Locus ID | 6464 |
UniProt ID | P29353 |
Protein Families | Druggable Genome |
Protein Pathways | Adherens junction, Arrhythmogenic right ventricular cardiomyopathy (ARVC), Chemokine signaling pathway, Chronic myeloid leukemia, Dilated cardiomyopathy, ErbB signaling pathway, Focal adhesion, Glioma, Hypertrophic cardiomyopathy (HCM), Insulin signaling pathway, Leukocyte transendothelial migration, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Pathogenic Escherichia coli infection, Regulation of actin cytoskeleton, Tight junction, Vibrio cholerae infection, Viral myocarditis |
Gene Summary | This gene encodes three main isoforms that differ in activities and subcellular location. While all three are adapter proteins in signal transduction pathways, the longest (p66Shc) may be involved in regulating life span and the effects of reactive oxygen species. The other two isoforms, p52Shc and p46Shc, link activated receptor tyrosine kinases to the Ras pathway by recruitment of the GRB2/SOS complex. p66Shc is not involved in Ras activation. Unlike the other two isoforms, p46Shc is targeted to the mitochondrial matrix. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (4) has an alternate 5' sequence and an alternate splice site in the CDS, as compared to variant 3. The resulting isoform (4), also known as p52Shc, has a shorter N-terminus and lacks an internal amino acid, as compared to isoform 3. |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Conformation-Dependent Human p52Shc Phosphorylation by Human c-Src
,Tsutsui, Y;Johnson, JM;Demeler, B;Kinter, MT;Hays, FA;,
Biochemistry
,PubMed ID 25961473
[SHC1]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225801 | SHC1 (Myc-DDK-tagged)-Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 4 |
CN¥ 3,656.00 |
|
RC225801L3 | Lenti-ORF clone of SHC1 (Myc-DDK-tagged)-Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 4 |
CN¥ 5,890.00 |
|
RC225801L4 | Lenti-ORF clone of SHC1 (mGFP-tagged)-Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 4 |
CN¥ 5,890.00 |
|
RG225801 | SHC1 (tGFP-tagged) - Human SHC (Src homology 2 domain containing) transforming protein 1 (SHC1), transcript variant 4 |
CN¥ 4,370.00 |