PLP1 (NM_001128834) Human Untagged Clone

CAT#: SC322940

PLP1 (untagged)-Human proteolipid protein 1 (PLP1), transcript variant 3



  "NM_001128834" in other vectors (4)

CNY 6,270.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
PLP1 Rabbit polyclonal Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms GPM6C; HLD1; MMPL; PLP; PLP/DM20; PMD; SPG2
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC322940 representing NM_001128834.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGGCTTGTTAGAGTGCTGTGCAAGATGTCTGGTAGGGGCCCCCTTTGCTTCCCTGGTGGCCACTGGA
TTGTGTTTCTTTGGGGTGGCACTGTTCTGTGGCTGTGGACATGAAGCCCTCACTGGCACAGAAAAGCTA
ATTGAGACCTATTTCTCCAAAAACTACCAAGACTATGAGTATCTCATCAATGTGATCCATGCCTTCCAG
TATGTCATCTATGGAACTGCCTCTTTCTTCTTCCTTTATGGGGCCCTCCTGCTGGCTGAGGGCTTCTAC
ACCACCGGCGCAGTCAGGCAGATCTTTGGCGACTACAAGACCACCATCTGCGGCAAGGGCCTGAGCGCA
ACGGTAACAGGGGGCCAGAAGGGGAGGGGTTCCAGAGGCCAACATCAAGCTCATTCTTTGGAGCGGGTG
TGTCATTGTTTGGGAAAATGGCTAGGACATCCCGACAAGTTTGTGGGCATCACCTATGCCCTGACCGTT
GTGTGGCTCCTGGTGTTTGCCTGCTCTGCTGTGCCTGTGTACATTTACTTCAACACCTGGACCACCTGC
CAGTCTATTGCCTTCCCCAGCAAGACCTCTGCCAGTATAGGCAGTCTCTGTGCTGATGCCAGAATGTAT
GGTGTTCTCCCATGGAATGCTTTCCCTGGCAAGGTTTGTGGCTCCAACCTTCTGTCCATCTGCAAAACA
GCTGAGTTCCAAATGACCTTCCACCTGTTTATTGCTGCATTTGTGGGGGCTGCAGCTACACTGGTTTCC
CTGCTCACCTTCATGATTGCTGCCACTTACAACTTTGCCGTCCTTAAACTCATGGGCCGAGGCACCAAG
TTCTGA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001128834
Insert Size 834 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001128834.2
RefSeq Size 3152 bp
RefSeq ORF 834 bp
Locus ID 5354
UniProt ID P60201
Protein Families Druggable Genome, Transmembrane
MW 30.1 kDa
Gene Summary This gene encodes a transmembrane proteolipid protein that is the predominant component of myelin. The encoded protein may play a role in the compaction, stabilization, and maintenance of myelin sheaths, as well as in oligodendrocyte development and axonal survival. Mutations in this gene cause Pelizaeus-Merzbacher disease and spastic paraplegia type 2. Alternatively splicing results in multiple transcript variants, including the DM20 splice variant. [provided by RefSeq, Feb 2015]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1 and 3 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...