United States
Germany
Japan
United Kingdom
China
AP4S1 (NM_001128126) Human Untagged Clone
CAT＃: SC322849
AP4S1 (untagged)-Human adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | AP47B; CLA20; CLAPS4; CPSQ6; SPG52 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC322849 representing NM_001128126.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGATAAAATTTTTCCTCATGGTGAATAAACAAGGGCAGACTCGACTTTCTAAGTACTATGAACATGTG GATATTAATAAGCGTACACTTCTGGAAACAGAAGTCATAAAGAGCTGTCTCTCTCGATCCAATGAACAA TGCTCTTTCATTGAATATAAGGATTTTAAGCTGATATATCGGCAGTATGCAGCTCTCTTCATTGTGGTT GGAGTTAATGACACTGAGAACGAGATGGCTATTTATGAATTCATTCATAACTTTGTGGAAGTTTTAGAT GAGTATTTCAGCCGAGTGAGTGAATTAGATATAATGTTTAATTTGGATAAAGTACACATCATTTTGGAT GAGATGGTGTTAAATGGCTGCATTGTGGAAACTAACAGGGCAAGAATTCTTGCCCCTCTACTAATTCTT GATAAGATGTCAGAAAGCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001128126 |
| Insert Size | 435 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001128126.2 |
| RefSeq Size | 4260 bp |
| RefSeq ORF | 435 bp |
| Locus ID | 11154 |
| UniProt ID | Q9Y587 |
| Protein Pathways | Lysosome |
| MW | 17 kDa |
| Gene Summary | This gene encodes a member of the adaptor complexes small subunit protein family. These proteins are components of the heterotetrameric adaptor protein complexes, which play important roles in the secretory and endocytic pathways by mediating vesicle formation and sorting of integral membrane proteins. The encoded protein is the small subunit of adaptor protein complex-4, which is associated with both clathrin- and nonclathrin-coated vesicles. Mutations in this gene are associated with spastic quadriplegic cerebral palsy-6. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene, and a pseudogene of this gene is located on the long arm of chromosome 6. [provided by RefSeq, Dec 2011] Transcript Variant: This variant (2) uses an alternate splice site in the 3' coding region and has an alternate terminal exon, compared to variant 1. Variants 2, 5 and 6 encode the same isoform (2), which is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC225121 | AP4S1 (Myc-DDK-tagged)-Human adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 2 |
CNY 1,200.00 |
|
| RC225121L3 | Lenti ORF clone of Human adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC225121L4 | Lenti ORF clone of Human adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG225121 | AP4S1 (tGFP-tagged) - Human adaptor-related protein complex 4, sigma 1 subunit (AP4S1), transcript variant 2 |
CNY 4,370.00 |
