LYRM1 (NM_001128302) Human Untagged Clone
CAT#: SC322825
LYRM1 (untagged)-Human LYR motif containing 1 (LYRM1), transcript variant 3
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | A211C6.1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC322825 representing NM_001128302.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGACAACGGCAACACGACAAGAAGTCCTTGGCCTCTACCGCAGCATTTTCAGGCTTGCGAGGAAATGG CAGGCGACATCAGGGCAGATGGAAGACACCATCAAAGAAAAACAGTACATACTAAATGAAGCCAGAACG CTGTTCCGGAAAAACAAAAATCTCACGGACACAGACCTAATTAAACAGTGTATAGATGAATGCACAGCC AGGATTGAAATTGGACTGCATTACAAGATTCCTTACCCAAGGCCAATTCATCTGCCTCCAATGGGCCTT ACCCCACTCCGAGGCCGGGGACTTCGAAGCCAAGAGAAACTGAGGAAACTTTCCAAACCAGTATATCTC AGATCTCATGATGAAGTTTCCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001128302 |
Insert Size | 369 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001128302.2 |
RefSeq Size | 1512 bp |
RefSeq ORF | 369 bp |
Locus ID | 57149 |
UniProt ID | O43325 |
MW | 14.3 kDa |
Gene Summary | The protein encoded by this gene belongs to the mitochondrial leucine/tyrosine/arginine motif family of proteins. Proteins of this family are short polypeptides that contain a leucine/tyrosine/arginine motif near the N-terminus. This gene is widely expressed with high levels in omental adipose tissue of obese individuals. In adipose tissue, the protein is localized to the nucleus where it promotes preadipocyte proliferation and lowers the rate of apoptosis to regulate adipose tissue homeostasis. Overexpression of this gene in adipocytes causes abnormal mitochondrial morphology and mitochondrial dysfunction. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014] Transcript Variant: This variant (3) differs in its 5' UTR compared to variant 1. Variants 1, 2, 3, 4, and 5 all encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225067 | LYRM1 (Myc-DDK-tagged)-Human LYR motif containing 1 (LYRM1), transcript variant 3 |
CNY 1,200.00 |
|
RC225067L3 | Lenti ORF clone of Human LYR motif containing 1 (LYRM1), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225067L4 | Lenti ORF clone of Human LYR motif containing 1 (LYRM1), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
RG225067 | LYRM1 (tGFP-tagged) - Human LYR motif containing 1 (LYRM1), transcript variant 3 |
CNY 4,370.00 |