MTHFS (NM_006441) Human Untagged Clone

CAT#: SC322547

MTHFS (untagged)-Human 5,10-methenyltetrahydrofolate synthetase (5-formyltetrahydrofolate cyclo-ligase) (MTHFS), transcript variant 1



  "NM_006441" in other vectors (5)

CN¥ 2,400.00

CN¥ 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00


MTHFS rabbit polyclonal antibody
    • 25 ul

CN¥ 800.00
CN¥ 1,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HsT19268; NEDMEHM
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322547 AGACCGAACCCGAGGGCGCCCAGGGCGCCGAGGGCGGGACTGGACTCGGCTTGGGCGTGA
GATGGCGGCGGCAGCGGTGAGCAGCGCCAAGCGTAGCCTGCGGGGAGAGCTGAAGCAGCG
TCTGCGGGCGATGAGTGCCGAGGAGCGGCTACGCCAGTCCCGCGTACTGAGCCAGAAGGT
GATTGCCCACAGTGAGTATCAAAAGTCCAAAAGAATTTCCATCTTTCTGAGCATGCAAGA
TGAAATTGAGACAGAAGAGATCATCAAGGACATTTTCCAACGAGGCAAAATCTGCTTCAT
CCCTCGGTACCGGTTCCAGAGCAATCACATGGATATGGTGAGAATAGAATCACCAGAGGA
AATTTCTTTACTTCCCAAAACATCCTGGAATATCCCTCAGCCTGGTGAGGGTGATGTTCG
GGAGGAGGCCTTGTCCACAGGGGGACTTGATCTCATCTTCATGCCAGGCCTTGGGTTTGA
CAAACATGGCAACCGACTGGGGAGGGGCAAGGGCTACTATGATGCCTATCTGAAGCGCTG
TTTGCAGCATCAGGAAGTGAAGCCCTACACCCTGGCGTTGGCTTTCAAAGAACAGATTTG
CCTCCAGGTCCCAGTGAATGAAAACGACATGAAGGTAGATGAAGTCCTTTACGAAGACTC
GTCAACAGCTTAAATCTGGATTACTACAGCCAAATAATCAGTGTTTTATATGAGAGTAAA
GCAAAGTATGTGTATTTTTCCCTTGTCAAAAATTAGTTGAAATTGTTCATTAATGTGAAT
ACAGACTGCATTTTAAAATTGTAATTATGAAATACCTTATATAAAACCATCTTTAAAAAC
CAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_006441
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_006441.1, NP_006432.1
RefSeq Size 857 bp
RefSeq ORF 612 bp
Locus ID 10588
UniProt ID P49914
Domains 5-FTHF_cyc-lig
Protein Pathways Metabolic pathways, One carbon pool by folate
Gene Summary The protein encoded by this gene is an enzyme that catalyzes the conversion of 5-formyltetrahydrofolate to 5,10-methenyltetrahydrofolate, a precursor of reduced folates involved in 1-carbon metabolism. An increased activity of the encoded protein can result in an increased folate turnover rate and folate depletion. Three transcript variants encoding two different isoforms have been found for this gene. [provided by RefSeq, Jun 2011]
Transcript Variant: This variant (1) encodes the longer isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...