United States
Germany
Japan
United Kingdom
China
spindlin 1 (SPIN1) (NM_006717) Human Untagged Clone
CAT＃: SC322356
SPIN1 (untagged)-Human spindlin 1 (SPIN1)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | SPIN; TDRD24 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>NCBI ORF sequence for NM_006717, the custom clone sequence may differ by one or more nucleotides
ATGAAGACCCCATTCGGAAAGACACCTGGCCAGCGGTCCAGAGCTGATGCAGGCCATGCTGGAGTATCTG CCAACATGATGAAGAAGAGGACATCCCACAAAAAACATCGGAGCAGTGTGGGTCCGAGCAAACCTGTTTC CCAGCCCCGGCGGAACATCGTAGGCTGCAGGATTCAGCATGGGTGGAAAGAGGGGAATGGCCCTGTTACC CAGTGGAAAGGAACCGTTCTGGACCAGGTGCCTGTAAATCCTTCTTTGTATCTTATAAAATACGATGGAT TTGACTGTGTTTATGGACTAGAACTTAATAAAGATGAAAGAGTTTCTGCGCTTGAAGTCCTCCCTGATAG AGTTGCGACATCTCGAATCAGCGATGCACACTTGGCAGACACAATGATTGGCAAAGCAGTGGAACATATG TTTGAGACAGAGGATGGTTCTAAAGATGAGTGGAGGGGAATGGTCTTAGCACGTGCACCTGTCATGAACA CATGGTTTTACATTACCTATGAGAAAGACCCTGTCTTGTACATGTACCAACTCTTAGATGATTACAAAGA AGGCGACCTTCGCATTATGCCTGATTCCAATGATTCACCTCCAGCAGAAAGGGAACCAGGAGAAGTTGTG GACAGCCTGGTAGGCAAACAAGTGGAATATGCCAAAGAAGATGGCTCGAAAAGGACTGGCATGGTCATTC ATCAAGTAGAAGCCAAGCCCTCCGTCTATTTCATCAAGTTTGATGATGATTTCCATATTTATGTCTACGA TTTGGTGAAAACATCCTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_006717 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_006717.2, NP_006708.2 |
| RefSeq Size | 4535 bp |
| RefSeq ORF | 789 bp |
| Locus ID | 10927 |
| UniProt ID | Q9Y657 |
| Domains | Spin-Ssty |
| Gene Summary | Chromatin reader that specifically recognizes and binds histone H3 both trimethylated at 'Lys-4' and asymmetrically dimethylated at 'Arg-8' (H3K4me3 and H3R8me2a) and acts as an activator of Wnt signaling pathway downstream of PRMT2. In case of cancer, promotes cell cancer proliferation via activation of the Wnt signaling pathway (PubMed:24589551). Overexpression induces metaphase arrest and chromosomal instability. Localizes to active rDNA loci and promotes the expression of rRNA genes (PubMed:21960006). May play a role in cell-cycle regulation during the transition from gamete to embryo. Involved in oocyte meiotic resumption, a process that takes place before ovulation to resume meiosis of oocytes blocked in prophase I: may act by regulating maternal transcripts to control meiotic resumption.[UniProtKB/Swiss-Prot Function] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC201938 | SPIN1 (Myc-DDK-tagged)-Human spindlin 1 (SPIN1) |
CNY 2,400.00 |
|
| RC201938L1 | Lenti ORF clone of Human spindlin 1 (SPIN1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201938L2 | Lenti ORF clone of Human spindlin 1 (SPIN1), mGFP tagged |
CNY 5,890.00 |
|
| RC201938L3 | Lenti ORF clone of Human spindlin 1 (SPIN1), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC201938L4 | Lenti ORF clone of Human spindlin 1 (SPIN1), mGFP tagged |
CNY 4,800.00 |
|
| RG201938 | SPIN1 (tGFP-tagged) - Human spindlin 1 (SPIN1) |
CNY 4,000.00 |
|
| SC108548 | SPIN1 (untagged)-Human spindlin 1 (SPIN1) |
CNY 2,400.00 |
其它spindlin 1产品
