BLOC1S2 (NM_001001342) Human Untagged Clone
CAT#: SC322335
BLOC1S2 (untagged)-Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BLOS2; BORCS2; CEAP; CEAP11 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322335
CTGAGGAAGCAAAGGAGCCTGCTGAAGCTGACATCACTGAGCTCTGCCGGGACATGTTCT
CCAAAATGGCCACTTACCTGACTGGGGAACTGACGGCCACCAGTGAAGACTATAAGCTCC TGGAAAATATGAATAAACTCACCAGCTTGAAGTATCTTGAAATGAAAGATATTGCTATAA ACATTAGTAGGAACTTAAAGGACTTAAACCAGAAATATGCTGGACTGCAGCCTTATCTGG ATCAGATCAATGTCATTGAAGAGCAGGTAGCAGCTCTTGAGCAGGCAGCTTACAAGTTGG ATGCATATTCAAAAAAACTGGAAGCCAAGTACAAGAAGCTGGAGAAGCGATGAGAAACTT ATTTCTATGGGACAGAGTCTTTTTTTTTTAATGTGGAAGAATGTCTTATAAAACCTGAAT CCTGAGGCTGATGAATTGTGAAAATTCCTCAAAAGGAAATTATGCTGGTCATCACAGGAA CATCTCAACGTTCGAGTAAACTGGAGGACTGTGGCTATTCCTGAACCTTCTTTGAGACAG AATCCCTCAGAATCTCACACTTATAACTTCCTACCTTTTACTTGAATGCTTTGCCATATT CAGGACAGAGACTCTCACAAAGTTCAGAAAACAGCTGGACTTACCAGTAAAATCAAATGA GAGGACCTATTTTCTCTGGTAGTGGTTGATTACTACATTATTTTCTTAAGTGGCTGGTTT TTTAGTTACTATGTAAATGGTCGTTTTTCTGTTAATGATGCTAATGTGTTGTAAACAAGA TTCTAAATTTAAAAAGGAAAACAAAACAAACTTGTTCTTTGCAGCTTATCACCTTGTGAA TGTCGGTAACTTACTTTTCCATAATATTGCAAATAACATAAAATCTTAAAATAATTCCAA GCTGAGTCTTCTAGATTGAGCAGAAATGGTGAAAGGAGTATTGATAACTTGGCGTATGTG ATGGGCCCCTCTTGTTTATTTTCTATGTGAGTCACATTGACATGCGATCAGTTTGGGAAA TGTGATGAAAACAAAGACTAGATGGGTATGTGTGTTTATGTGTTGGGTAGGGAGGTGACG ATTGCCACTCATAAAATAAAGGATTTTATAAAATAAAAAAAAAAAAAAAAAAAAAAAAAA AA |
Restriction Sites | Please inquire |
ACCN | NM_001001342 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001342.1, NP_001001342.1 |
RefSeq Size | 2024 bp |
RefSeq ORF | 300 bp |
Locus ID | 282991 |
UniProt ID | Q6QNY1 |
Gene Summary | This gene encodes a protein with multiple functions. The encoded protein has been found in association with the centrosome, shown to co-localize with gamma-tubulin, and also found to be one of the proteins in the BLOC-1 complex which functions in the formation of lysosome-related organelles. A pseudogene of this gene is located on the X chromosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Feb 2012] Transcript Variant: This variant (2) uses an alternate 5' exon structure and thus differs in the 5' UTR and 5' coding region compared to variant 1. These differences cause translation initiation at a downstream AUG and result in an isoform (2) with a shorter N-terminus, compared to isoform 1. Variants 2, 4, and 5 encode the same isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202351 | BLOC1S2 (Myc-DDK-tagged)-Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2 |
CNY 1,200.00 |
|
RC202351L3 | Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202351L4 | Lenti ORF clone of Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG202351 | BLOC1S2 (tGFP-tagged) - Human biogenesis of lysosomal organelles complex-1, subunit 2 (BLOC1S2), transcript variant 2 |
CNY 2,800.00 |
其它BLOC1S2产品