EPCAM (NM_002354) Human Untagged Clone
CAT#: SC322331
EPCAM (untagged)-Human epithelial cell adhesion molecule (EPCAM)
CNY 2,400.00
CNY 2,950.00
Cited in 5 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DIAR5; EGP-2; EGP40; EGP314; ESA; HNPCC8; KS1/4; KSA; M4S1; MIC18; MK-1; TACSTD1; TROP1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322331
CCTTCGGCGAGCGAGCACCTTCGACGCGGTCCGGGGACCCCCTCGTCGCTGTCCTCCCGA
CGCGGACCCGCGTGCCCCAGGCCTCGCGCTGCCCGGCCGGCTCCTCGTGTCCCACTCCCG GCGCACGCCCTCCCGCGAGTCCCGGGCCCCTCCCGCGCCCCTCTTCTCGGCGCGCGCGCA GCATGGCGCCCCCGCAGGTCCTCGCGTTCGGGCTTCTGCTTGCCGCGGCGACGGCGACTT TTGCCGCAGCTCAGGAAGAATGTGTCTGTGAAAACTACAAGCTGGCCGTAAACTGCTTTG TGAATAATAATCGTCAATGCCAGTGTACTTCAGTTGGTGCACAAAATACTGTCATTTGCT CAAAGCTGGCTGCCAAATGTTTGGTGATGAAGGCAGAAATGAATGGCTCAAAACTTGGGA GAAGAGCAAAACCTGAAGGGGCCCTCCAGAACAATGATGGGCTTTATGATCCTGACTGCG ATGAGAGCGGGCTCTTTAAGGCCAAGCAGTGCAACGGCACCTCCACGTGCTGGTGTGTGA ACACTGCTGGGGTCAGAAGAACAGACAAGGACACTGAAATAACCTGCTCTGAGCGAGTGA GAACCTACTGGATCATCATTGAACTAAAACACAAAGCAAGAGAAAAACCTTATGATAGTA AAAGTTTGCGGACTGCACTTCAGAAGGAGATCACAACGCGTTATCAACTGGATCCAAAAT TTATCACGAGTATTTTGTATGAGAATAATGTTATCACTATTGATCTGGTTCAAAATTCTT CTCAAAAAACTCAGAATGATGTGGACATAGCTGATGTGGCTTATTATTTTGAAAAAGATG TTAAAGGTGAATCCTTGTTTCATTCTAAGAAAATGGACCTGACAGTAAATGGGGAACAAC TGGATCTGGATCCTGGTCAAACTTTAATTTATTATGTTGATGAAAAAGCACCTGAATTCT CAATGCAGGGTCTAAAAGCTGGTGTTATTGCTGTTATTGTGGTTGTGGTGATAGCAGTTG TTGCTGGAATTGTTGTGCTGGTTATTTCCAGAAAGAAGAGAATGGCAAAGTATGAGAAGG CTGAGATAAAGGAGATGGGTGAGATGCATAGGGAACTCAATGCATAACTATATAATTTGA AGATTATAGAAGAAGGGAAATAGCAAATGGACACAAATTACAAATGTGTGTGCGTGGGAC GAAGACATCTTTGAAGGTCATGAGTTTGTTAGTTTAACATCATATATTTGTAATAGTGAA ACCTGTACTCAAAATATAAGCAGCTTGAAACTGGCTTTACCAATCTTGAAATTTGACCAC AAGTGTCTTATATATGCAGATCTAATGTAAAATCCAGAACTTGGACTCCATCGTTAAAAT TATTTATGTGTAACATTCAAATGTGTGCATTAAATATGCTTCCACAGTAAAATCTGAAAA ACTGAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002354 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002354.1, NP_002345.1 |
RefSeq Size | 1528 bp |
RefSeq ORF | 945 bp |
Locus ID | 4072 |
UniProt ID | P16422 |
Domains | thyroglobulin_1 |
Protein Families | ES Cell Differentiation/IPS, Transmembrane |
Gene Summary | This gene encodes a carcinoma-associated antigen and is a member of a family that includes at least two type I membrane proteins. This antigen is expressed on most normal epithelial cells and gastrointestinal carcinomas and functions as a homotypic calcium-independent cell adhesion molecule. The antigen is being used as a target for immunotherapy treatment of human carcinomas. Mutations in this gene result in congenital tufting enteropathy. [provided by RefSeq, Dec 2008] |
Citations (5)
The use of this cDNA Clones has been cited in the following citations: |
---|
Viral and tumor antigen-specific CD8 T-cell responses in Merkel cell carcinoma
,Samimi, M;Benlalam, H;Aumond, P;Gaboriaud, P;Fradin, D;Kervarrec, T;Florenceau, L;Vignard, V;Blom, A;Touzé, A;Gervois, N;Labarriere, N;,
Cell. Immunol.
,PubMed ID 31472938
[EPCAM]
|
Regulation of epithelial migration by epithelial cell adhesion molecule requires its Claudin-7 interaction domain
,null,
PLoS ONE
,PubMed ID 30304739
[EPCAM]
|
Off-target-free gene delivery by affinity-purified receptor-targeted viral vectors
,Münch, RC;Muth, A;Muik, A;Friedel, T;Schmatz, J;Dreier, B;Trkola, A;Plückthun, A;Büning, H;Buchholz, CJ;,
Nat Commun
,PubMed ID 25665714
[EPCAM]
|
Epithelial cell adhesion molecule (EpCAM) is associated with prostate cancer metastasis and chemo/radioresistance via the PI3K/Akt/mTOR signaling pathway
,Ni, J;Cozzi, P;Hao, J;Beretov, J;Chang, L;Duan, W;Shigdar, S;Delprado, W;Graham, P;Bucci, J;Kearsley, J;Li, Y;,
,PubMed ID 24076216
[EPCAM]
|
Ep-CAM is a significant prognostic factor in pancreatic cancer patients by suppressing cell activity
,H Akita, H Nagano, Y Takeda, H Eguchi, H Wada, S Kobayashi, S Marubashi, M Tanemura, H Takahashi, H Ohigashi, et al.,
Oncogene (14 March 2011) doi:10.1038/onc.2011.59 Original Article
[EPCAM]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201989 | EPCAM (Myc-DDK-tagged)-Human epithelial cell adhesion molecule (EPCAM) |
CNY 2,400.00 |
|
RC201989L1 | Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201989L2 | Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), mGFP tagged |
CNY 4,800.00 |
|
RC201989L3 | Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC201989L4 | Lenti ORF clone of Human epithelial cell adhesion molecule (EPCAM), mGFP tagged |
CNY 4,800.00 |
|
RG201989 | EPCAM (tGFP-tagged) - Human epithelial cell adhesion molecule (EPCAM) |
CNY 4,000.00 |
|
SC118692 | EPCAM (untagged)-Human epithelial cell adhesion molecule (EPCAM) |
CNY 2,400.00 |