AGA (NM_000027) Human Untagged Clone
CAT#: SC322314
AGA (untagged)-Human aspartylglucosaminidase (AGA), transcript variant 1
CNY 3,656.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AGU; ASRG; GA |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for SC322314
GATCGCTGGCTGCCGGGACTTTTCTCGCGCTGGTCTCTTCGGTGGTCAGGGATGGCGCGG
AAGTCGAACTTGCCTGTGCTTCTCGTGCCGTTTCTGCTCTGCCAGGCCCTAGTGCGCTGC TCCAGCCCTCTGCCCCTGGTCGTCAACACTTGGCCCTTTAAGAATGCAACCGAAGCAGCG TGGAGGGCATTAGCATCTGGAGGCTCTGCCCTGGATGCAGTGGAGAGCGGCTGTGCCATG TGTGAGAGAGAGCAGTGTGACGGCTCTGTAGGCTTTGGAGGAAGTCCTGATGAACTTGGA GAAACCACACTAGATGCCATGATCATGGATGGCACTACTATGGATGTAGGAGCAGTAGGA GATCTCAGACGAATTAAAAATGCTATTGGTGTGGCACGGAAAGTACTGGAACATACAACA CACACACTTTTAGTAGGAGAGTCAGCCACCACATTTGCTCAAAGTATGGGGTTTATCAAT GAAGACTTATCTACCAGTGCTTCTCAAGCTCTTCATTCAGATTGGCTTGCTCGGAATTGC CAGCCAAATTATTGGAGGAATGTTATACCAGATCCCTCAAAATACTGCGGACCCTACAAA CCACCTGGTATCTTAAAGCAGGATATTCCTATCCATAAAGAAACAGAAGATGATCGTGGT CATGACACTATTGGCATGGTTGTAATCCATAAGACAGGACATATTGCTGCTGGTACATCT ACAAATGGTATAAAATTCAAAATACATGGCCGTGTAGGAGACTCACCAATACCTGGAGCT GGAGCCTATGCTGACGATACTGCAGGGGCAGCCGCAGCCACTGGGAATGGTGATATATTG ATGCGCTTCCTGCCAAGCTACCAAGCTGTAGAATACATGAGAAGAGGAGAAGATCCAACC ATAGCTTGCCAAAAAGTGATTTCAAGAATCCAGAAGCATTTTCCAGAATTCTTTGGGGCT GTTATATGTGCCAATGTGACTGGAAGTTACGGTGCTGCTTGCAATAAACTTTCAACATTT ACTCAGTTTAGTTTCATGGTTTATAATTCCGAAAAAAATCAGCCAACTGAGGAAAAAGTG GACTGCATCTAATCCATCTTTACTGTCAACATCTGTATTTAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000027 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_000027.2, NP_000018.1 |
RefSeq Size | 2041 bp |
RefSeq ORF | 1041 bp |
Locus ID | 175 |
UniProt ID | P20933 |
Domains | Asparaginase_2 |
Protein Families | Druggable Genome, Protease |
Protein Pathways | Lysosome, Other glycan degradation |
Gene Summary | This gene encodes a member of the N-terminal nucleophile (Ntn) hydrolase family of proteins. The encoded preproprotein is proteolytically processed to generate alpha and beta chains that comprise the mature enzyme. This enzyme is involved in the catabolism of N-linked oligosaccharides of glycoproteins. It cleaves asparagine from N-acetylglucosamines as one of the final steps in the lysosomal breakdown of glycoproteins. Mutations in this gene are associated with the lysosomal storage disease aspartylglycosaminuria that results in progressive neurodegeneration. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is subject to proteolytic processing. [provided by RefSeq, Nov 2015] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC201975 | AGA (Myc-DDK-tagged)-Human aspartylglucosaminidase (AGA), transcript variant 1 |
CNY 3,656.00 |
|
RC201975L3 | Lenti ORF clone of Human aspartylglucosaminidase (AGA), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC201975L4 | Lenti ORF clone of Human aspartylglucosaminidase (AGA), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG201975 | AGA (tGFP-tagged) - Human aspartylglucosaminidase (AGA), transcript variant 1 |
CNY 4,370.00 |
|
SC117330 | AGA (untagged)-Human aspartylglucosaminidase (AGA), transcript variant 1 |
CNY 3,656.00 |