POLR1D (NM_015972) Human Untagged Clone

CAT#: SC322230

POLR1D (untagged)-Human polymerase (RNA) I polypeptide D, 16kDa (POLR1D), transcript variant 1



  "NM_015972" in other vectors (7)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


POLR1D rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms AC19; POLR1C; RPA9; RPA16; RPAC2; RPC16; RPO1-3; TCS2
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for SC322230 GCCTTCCGTCGGTCGGTCCTTGCTTCCTGCTTCGCCTCCGCGCCTCGCGCTATGGGACAG
AGCCCCCGATCCGCCAGCACCACCTGAGGATCCAGAAACCGCCCCAGCGATGGAAGAGGA
TCAGGAGCTGGAGAGAAAAATATCTGGATTGAAGACCTCAATGGCTGAAGGCGAGAGGAA
GACAGCCCTGGAAATGGTCCAGGCAGCTGGAACAGATAGACACTGTGTGACATTTGTATT
GCACGAGGAAGACCATACCCTAGGAAATTCTCTACGTTACATGATCATGAAGAACCCGGA
AGTGGAATTTTGTGGTTACACTACGACCCATCCTTCAGAGAGCAAAATTAATTTACGCAT
TCAGACTCGAGGTACCCTTCCAGCTGTTGAGCCATTTCAGAGAGGCCTGAATGAGCTCAT
GAATGTCTGCCAACATGTGCTTGACAAGTTTGAGGCCAGCATAAAGGACTATAAGGATCA
AAAAGCAAGCAGAAATGAATCCACATTCTAGTCCTTTATGCAGTATACAAGGAGAACTGT
CCTGTAGGATATTCTCTTCCTGATGGTGCAGAACCCAGAATTAGAAGTTTGTGGTTACAG
CATACTCTGTCCTTCAGAAAGGCGTGATTCTAGCTGTTGACCCCTTGCAGCTGTTGGAAT
CTCTGCAAGAACCTCTGTATTCTTCTAATAAATTCCCTCTTTTATTTAAACTAAAAAAAA
AAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_015972
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015972.1, NP_057056.1
RefSeq Size 726 bp
RefSeq ORF 402 bp
Locus ID 51082
UniProt ID P0DPB6
Domains RNA_pol_L
Protein Families Stem cell - Pluripotency, Transcription Factors
Protein Pathways Cytosolic DNA-sensing pathway, Metabolic pathways, Purine metabolism, Pyrimidine metabolism, RNA polymerase
Gene Summary The protein encoded by this gene is a component of the RNA polymerase I and RNA polymerase III complexes, which function in the synthesis of ribosomal RNA precursors and small RNAs, respectively. Mutations in this gene are a cause of Treacher Collins syndrome (TCS), a craniofacial development disorder. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Apr 2011]
Transcript Variant: This variant (1) represents the shortest transcript but encodes the longest isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...