United States
Germany
Japan
United Kingdom
China
MDMX (MDM4) (NM_002393) Human Untagged Clone
CAT＃: SC322031
MDM4 (untagged)-Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1
CNY 5,488.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BMFS6; HDMX; MDMX; MRP1 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for SC322031
CCGGAAGTTGCGGCTTCATTACTCGCCATTTCAAAATGCTGCCGAGGCCCTAGGATCTGT
GACTGCCACCCCTCCCCCCACCCGGGCTCGGCGGGGGAGCGACTCATGGAGCTGCCGTAA GTTTTACCAACAGACTGCAGTTTCTTCACTACCAAAATGACATCATTTTCCACCTCTGCT CAGTGTTCAACATCTGACAGTGCTTGCAGGATCTCTCCTGGACAAATCAATCAGGTACGA CCAAAACTGCCGCTTTTGAAGATTTTGCATGCAGCAGGTGCGCAAGGTGAAATGTTCACT GTTAAAGAGGTCATGCACTATTTAGGTCAGTACATAATGGTGAAGCAACTTTATGATCAG CAGGAGCAGCATATGGTATATTGTGGTGGAGATCTTTTGGGAGAACTACTGGGACGTCAG AGCTTCTCCGTGAAAGACCCAAGCCCTCTCTATGATATGCTAAGAAAGAATCTTGTCACT TTAGCCACTGCTACTACAGATGCTGCTCAGACTCTCGCTCTCGCACAGGATCACAGTATG GATATTCCAAGTCAAGACCAACTGAAGCAAAGTGCAGAGGAAAGTTCCACTTCCAGAAAA AGAACTACAGAAGACGATATCCCCACACTGCCTACCTCAGAGCATAAATGCATACATTCT AGAGAAGATGAAGACTTAATTGAAAATTTAGCCCAAGATGAAACATCTAGGCTGGACCTT GGATTTGAGGAGTGGGATGTAGCTGGCCTGCCTTGGTGGTTTTTAGGAAACTTGAGAAGC AACTATACACCTAGAAGTAATGGCTCAACTGATTTACAGACAAATCAGGATGTGGGTACT GCCATTGTTTCAGATACTACAGATGACTTGTGGTTTTTGAATGAGTCAGTATCAGAGCAG TTAGGTGTTGGAATAAAAGTTGAAGCTGCTGATACTGAACAAACAAGTGAAGAAGTAGGG AAAGTAAGTGACAAAAAGGTGATTGAAGTGGGAAAAAATGATGACCTGGAGGACTCTAAG TCCTTAAGTGATGATACCGATGTAGAGGTTACCTCTGAGGATGAGTGGCAGTGTACTGAA TGCAAGAAATTTAACTCTCCAAGCAAGAGGTACTGTTTTCGTTGTTGGGCCTTGAGGAAG GATTGGTATTCAGATTGTTCAAAGTTAACCCATTCTCTCTCCACGTCTGATATCACTGCC ATACCTGAAAAGGAAAATGAAGGAAATGATGTCCCTGATTGTCGAAGAACCATTTCGGCT CCTGTCGTTAGACCTAAAGATGCGTATATAAAGAAAGAAAACTCCAAACTTTTTGATCCC TGCAACTCAGTGGAATTCTTGGATTTGGCTCACAGTTCTGAAAGCCAAGAGACCATCTCA AGCATGGGAGAACAGTTAGATAACCTTTCTGAACAGAGAACAGATACAGAAAACATGGAG GATTGCCAGAATCTCTTGAAGCCATGTAGCTTATGTGAGAAAAGACCACGAGACGGGAAC ATTATTCATGGAAGGACGGGCCATCTTGTCACTTGTTTTCACTGTGCCAGAAGACTAAAG AAGGCTGGGGCTTCATGCCCTATTTGCAAGAAAGAGATTCAGCTGGTTATTAAGGTTTTT ATAGCATAATGGTAGTACGAACATAAAAATGCATTTATTCAGTTCACTTACAAAAAAAAA AAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_002393 |
| OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002393.2, NP_002384.2 |
| RefSeq Size | 2554 bp |
| RefSeq ORF | 1473 bp |
| Locus ID | 4194 |
| UniProt ID | O15151 |
| Domains | SWIB |
| Protein Families | Druggable Genome, Transcription Factors |
| Protein Pathways | p53 signaling pathway |
| Gene Summary | This gene encodes a nuclear protein that contains a p53 binding domain at the N-terminus and a RING finger domain at the C-terminus, and shows structural similarity to p53-binding protein MDM2. Both proteins bind the p53 tumor suppressor protein and inhibit its activity, and have been shown to be overexpressed in a variety of human cancers. However, unlike MDM2 which degrades p53, this protein inhibits p53 by binding its transcriptional activation domain. This protein also interacts with MDM2 protein via the RING finger domain, and inhibits the latter's degradation. So this protein can reverse MDM2-targeted degradation of p53, while maintaining suppression of p53 transactivation and apoptotic functions. Alternatively spliced transcript variants encoding different isoforms have been noted for this gene. [provided by RefSeq, Feb 2011] Transcript Variant: This variant (1, also known as MDM4-FL or HDMX) represents the predominant transcript, and encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209620 | MDM4 (Myc-DDK-tagged)-Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1 |
CNY 5,488.00 |
|
| RC209620L1 | Lenti ORF clone of Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC209620L2 | Lenti ORF clone of Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC209620L3 | Lenti ORF clone of Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1, Myc-DDK-tagged |
CNY 7,888.00 |
|
| RC209620L4 | Lenti ORF clone of Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1, mGFP tagged |
CNY 7,888.00 |
|
| RG209620 | MDM4 (tGFP-tagged) - Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1 |
CNY 7,088.00 |
|
| SC310334 | MDM4 (untagged)-Human Mdm4 p53 binding protein homolog (mouse) (MDM4), transcript variant 1 |
CNY 5,488.00 |
