SLC25A4 (NM_001151) Human Untagged Clone
CAT#: SC321924
SLC25A4 (untagged)-Human solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein
CN¥ 2,400.00
CN¥ 2,950.00
Cited in 1 publication. |
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AAC1; ANT; ANT 1; ANT1; MTDPS12; MTDPS12A; PEO2; PEO3; PEOA2; T1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001151.2
AGCGTCGCGCAGGGTCGGGGACTGCGCGGCGGTGCCAGGCCGGGCGTGGGCGAGAGCACG
AACGGGCTGCCTGCGGGCTGAGAGCGTCGAGCTGTCACCATGGGTGATCACGCTTGGAGC TTCCTAAAGGACTTCCTGGCCGGGGGCGTCGCCGCTGCCGTCTCCAAGACCGCGGTCGCC CCCATCGAGAGGGTCAAACTGCTGCTGCAGGTCCAGCATGCCAGCAAACAGATCAGTGCT GAGAAGCAGTACAAAGGGATCATTGATTGTGTGGTGAGAATCCCTAAGGAGCAGGGCTTC CTCTCCTTCTGGAGGGGTAACCTGGCCAACGTGATCCGTTACTTCCCCACCCAAGCTCTC AACTTCGCCTTCAAGGACAAGTACAAGCAGCTCTTCTTAGGGGGTGTGGATCGGCATAAG CAGTTCTGGCGCTACTTTGCTGGTAACCTGGCGTCCGGTGGGGCCGCTGGGGCCACCTCC CTTTGCTTTGTCTACCCGCTGGACTTTGCTAGGACCAGGTTGGCTGCTGATGTGGGCAAG GGCGCCGCCCAGCGTGAGTTCCATGGTCTGGGCGACTGTATCATCAAGATCTTCAAGTCT GATGGCCTGAGGGGGCTCTACCAGGGTTTCAACGTCTCTGTCCAAGGCATCATTATCTAT AGAGCTGCCTACTTCGGAGTCTATGATACTGCCAAGGGGATGCTGCCTGACCCCAAGAAC GTGCACATTTTTGTGAGCTGGATGATTGCCCAGAGTGTGACGGCAGTCGCAGGGCTGGTG TCCTACCCCTTTGACACTGTTCGTCGTAGAATGATGATGCAGTCCGGCCGGAAAGGGGCC GATATTATGTACACGGGGACAGTTGACTGCTGGAGGAAGATTGCAAAAGACGAAGGAGCC AAGGCCTTCTTCAAAGGTGCCTGGTCCAATGTGCTGAGAGGCATGGGCGGTGCTTTTGTA TTGGTGTTGTATGATGAGATCAAAAAATATGTCTAATGTAATTAAAACACAAGTTCACAG ATTTACAGTGAACTTGATCTACAAGTTCACAGATCCATTGTGTGGTTTAATAGACTATTC CTAGGGGAAGTAAAAAGATCTGGGATAAAACCAGACTGAAAGGAATACCTCAGAAGAGAT GCTTCATTGAGTGTTCATTAAACCACACATGTATTTTGTATTTATTTTACATTTAAATTC CCACAGCAAATAGAAAATAATTTATCATACTTGTACAATTAACTGAAGAATTGATAATAA CTGAATGTGAAACATCAATAAAGACCACTTAATGCAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001151 |
Insert Size | 1300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001151.2, NP_001142.2 |
RefSeq Size | 1340 bp |
RefSeq ORF | 897 bp |
Locus ID | 291 |
UniProt ID | P12235 |
Domains | mito_carr |
Protein Families | Druggable Genome, Transmembrane |
Protein Pathways | Calcium signaling pathway, Huntington's disease, Parkinson's disease |
Gene Summary | This gene is a member of the mitochondrial carrier subfamily of solute carrier protein genes. The product of this gene functions as a gated pore that translocates ADP from the cytoplasm into the mitochondrial matrix and ATP from the mitochondrial matrix into the cytoplasm. The protein forms a homodimer embedded in the inner mitochondria membrane. Mutations in this gene have been shown to result in autosomal dominant progressive external opthalmoplegia and familial hypertrophic cardiomyopathy. [provided by RefSeq, Jun 2013] |
Citations (1)
The use of this cDNA Clones has been cited in the following citations: |
---|
Targeting mitochondrial 18kDa Translocator protein (TSPO) regulates macrophage cholesterol efflux and lipid phenotype
,Taylor, JM;Allen, AM;Graham, A;,
Clin. Sci.
,PubMed ID 24814875
[SLC25A4]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC209091 | SLC25A4 (Myc-DDK-tagged)-Human solute carrier family 25 (mitochondrial carrier, adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein |
CN¥ 2,400.00 |
|
RC209091L1 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CN¥ 4,800.00 |
|
RC209091L2 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein, mGFP tagged |
CN¥ 5,890.00 |
|
RC209091L3 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein, Myc-DDK-tagged |
CN¥ 5,890.00 |
|
RC209091L4 | Lenti ORF clone of Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein, mGFP tagged |
CN¥ 4,800.00 |
|
RG209091 | SLC25A4 (tGFP-tagged) - Human solute carrier family 25 (mitochondrial carrier; adenine nucleotide translocator), member 4 (SLC25A4), nuclear gene encoding mitochondrial protein |
CN¥ 4,000.00 |
其它SLC25A4产品