United States
Germany
Japan
United Kingdom
China
SUSD4 (NM_001037175) Human Untagged Clone
CAT＃: SC321513
SUSD4 (untagged)-Human sushi domain containing 4 (SUSD4), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PRO222 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001037175.1
GGCACGAGGAGGAAGCTGCATGCATGAGACCCACAGACTCTTGCAAGCTGGATGCCCTCT
GTGGATGAAAGATGTATCATGGAATGAACCCGAGCAATGGAGATGGATTTCTAGAGCAGC AGCAGCAGCAGCAGCAACCTCAGTCCCCCCAGAGACTCTTGGCCGTGATCCTGTGGTTTC AGCTGGCGCTGTGCTTCGGCCCTGCACAGCTCACGGGCGGGTTCGATGACCTTCAAGTGT GTGCTGACCCCGGCATTCCCGAGAATGGCTTCAGGACCCCCAGCGGAGGGGTTTTCTTTG AAGGCTCTGTAGCCCGATTTCACTGCCAAGACGGATTCAAGCTGAAGGGCGCTACAAAGA GACTGTGTTTGAAGCATTTTAATGGAACCCTAGGCTGGATCCCAAGTGATAATTCCATCT GTGTGCAAGAAGATTGCCGTATCCCTCAAATCGAAGATGCTGAGATTCATAACAAGACAT ATAGACATGGAGAGAAGCTAATCATCACTTGTCATGAAGGATTCAAGATCCGGTACCCCG ACCTACACAATATGGTTTCATTATGTCGCGATGATGGAACGTGGAATAATCTGCCCATCT GTCAAGGCTGCCTGAGACCTCTAGCCTCTTCTAATGGCTATGTAAACATCTCTGAGCTCC AGACCTCCTTCCCGGTGGGGACTGTGATCTCCTATCGCTGCTTTCCCGGATTTAAACTTG ATGGGTCTGCGTATCTTGAGTGCTTACAAAACCTTATCTGGTCGTCCAGCCCACCCCGGT GCCTTGCTCTGGAAGGAGGAAGACCTGAACATCTTTTCCCTGTCCTTTATTTCCCACACA TCAGGTTGGCAGCTGCTGTGCTTTATTTTTGCCCTGTGTTAAAGTCCTCTCCCACCCCAG CACCTACCTGTTCCTCAACTAGCACCACCACATCTCTGTTCTAAATGTTGTTCTCCTGCA ATAAAGGACGTTTGAATTAAACATTCAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001037175 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001037175.1, NP_001032252.1 |
| RefSeq Size | 1044 bp |
| RefSeq ORF | 873 bp |
| Locus ID | 55061 |
| UniProt ID | Q5VX71 |
| Protein Families | Transmembrane |
| Gene Summary | Acts as complement inhibitor by disrupting the formation of the classical C3 convertase. Isoform 3 inhibits the classical complement pathway, while membrane-bound isoform 1 inhibits deposition of C3b via both the classical and alternative complement pathways.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (2) differs in the 3' UTR and coding region compared to variant 1. The resulting isoform (b) is shorter and has a distinct C-terminus compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202622 | SUSD4 (Myc-DDK-tagged)-Human sushi domain containing 4 (SUSD4), transcript variant 2 |
CNY 2,400.00 |
|
| RC202622L1 | Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC202622L2 | Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RC202622L3 | Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC202622L4 | Lenti ORF clone of Human sushi domain containing 4 (SUSD4), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG202622 | SUSD4 (tGFP-tagged) - Human sushi domain containing 4 (SUSD4), transcript variant 2 |
CNY 4,000.00 |
