AGPAT2 (NM_006412) Human Untagged Clone
CAT#: SC321376
AGPAT2 (untagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1
CNY 3,600.00
Cited in 2 publications. |
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 1-AGPAT2; BSCL; BSCL1; LPAAB; LPAAT-beta |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_006412.3
GGAGCGGGAGCGAGCTGGCGGCGCCGTCGGGCGCCGGGCCGGGCCATGGAGCTGTGGCCG
TGTCTGGCCGCGGCGCTGCTGTTGCTGCTGCTGCTGGTGCAGCTGAGCCGCGCGGCCGAG TTCTACGCCAAGGTCGCCCTGTACTGCGCGCTGTGCTTCACGGTGTCCGCCGTGGCCTCG CTCGTCTGCCTGCTGCGCCACGGCGGCCGGACGGTGGAGAACATGAGCATCATCGGCTGG TTCGTGCGAAGCTTCAAGTACTTTTACGGGCTCCGCTTCGAGGTGCGGGACCCGCGCAGG CTGCAGGAGGCCCGTCCCTGTGTCATCGTCTCCAACCACCAGAGCATCCTGGACATGATG GGCCTCATGGAGGTCCTTCCGGAGCGCTGCGTGCAGATCGCCAAGCGGGAGCTGCTCTTC CTGGGGCCCGTGGGCCTCATCATGTACCTCGGGGGCGTCTTCTTCATCAACCGGCAGCGC TCTAGCACTGCCATGACAGTGATGGCCGACCTGGGCGAGCGCATGGTCAGGGAGAACCTC AAAGTGTGGATCTATCCCGAGGGTACTCGCAACGACAATGGGGACCTGCTGCCTTTTAAG AAGGGCGCCTTCTACCTGGCAGTCCAGGCACAGGTGCCCATCTTCCCCGTGGTGTACTCT TCCTTCTCCTCCTTCTACAACACCAAGAAGAAGTTCTTCACTTCAGGAACAGTCACAGTG CAGGTGCTGGAAGCCATCCCCACCAGCGGCCTCACTGCGGCGGACGTCCCTGCGCTCGTG GACACCTGCCACCGGGCCATGAGGACCACCTTCCTCCACATCTCCAAGACCCCCCAGGAG AACGGGGCCACTGCGGGGTCTGGCGTGCAGCCGGCCCAGTAGCCCAGACCACGGCAGGGC ATGACCTGGGGAGGGCAGGTGGAAGCCGATGGCTGGAGGATGGGCAGAGGGGACTCCTCC CGGCTTCCAAATACCACTCTGTCCGGCTCCCCCAGCTCTCACTCAGCCCGGGAAGCAGGA AGCCCCTTCTGTCACTGGTCTCAGACACAGGCCCCTGGTGTCCCCTGCAGGGGGCTCAGC TGGACCCTCCCCGGGCTCGAGGGCAGGGACTCGCGCCCACGGCACCTCTGGGAGCTGGGA TGATAAAGATGAGGCTTGCGGCTGTGGCCCGCTGGTGGGCTGAGCCACAAGGCCCCCGAT GGCCCAGGAGCAGATGGGAGGACCCCGAGGCCAGACGCACACTGTCCGAGCCCTCTGCTC AGCCGCCTGGGACCCACCAGGGTGCAGCTGGGCTCCAGGGTCCAGCCCACAAGCTGCATC AGGGTCTCTGGGAGAGGAGGGGCCTGGAGGGCCAGGAGTCCCAGACTCACGCACCCTGGG CCACAGGGAGCCGGGAATCGGGGCCTGCTGCTCCTGCTGGCCTGGAAGACTCTGTGGGGT CAGCACTGTACTCCGTTGCTGTTTTTTTATAAACACACTCTTGGAAGTGGCAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_006412 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_006412.3, NP_006403.2 |
RefSeq Size | 1576 bp |
RefSeq ORF | 837 bp |
Locus ID | 10555 |
UniProt ID | O15120 |
Domains | Acyltransferase |
Protein Families | Transmembrane |
Protein Pathways | Ether lipid metabolism, Glycerolipid metabolism, Glycerophospholipid metabolism, Metabolic pathways |
Gene Summary | This gene encodes a member of the 1-acylglycerol-3-phosphate O-acyltransferase family. The protein is located within the endoplasmic reticulum membrane and converts lysophosphatidic acid to phosphatidic acid, the second step in de novo phospholipid biosynthesis. Mutations in this gene have been associated with congenital generalized lipodystrophy (CGL), or Berardinelli-Seip syndrome, a disease characterized by a near absence of adipose tissue and severe insulin resistance. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript and encodes the longer isoform (a). |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
The microsomal cardiolipin remodeling enzyme acyl-CoA lysocardiolipin acyltransferase is an acyltransferase of multiple anionic lysophospholipids
,Yang Zhao, Yan-Qun Chen, Shuyu Li, Robert J. Konrad, and Guoqing Cao,
J. Lipid Res., May 2009; 50: 945 - 956.
[AGPAT2]
|
Identification and characterization of a lysophosphatidylcholine acyltransferase that is primarily expressed in metabolic tissues Yang Zhao, YanQun Chen, Tabetha M. Bonacci, David S. Bredt, Shuyu Li, William R. Bensch, David E. Moller, Mark Kowala, Robert J. Konrad, and Guoqing Cao
,Yang Zhao, YanQun Chen, Tabetha M. Bonacci, David S. Bredt, Shuyu Li, William R. Bensch, David E. Moller, Mark Kowala, Robert J. Konrad, and Guoqing Cao,
J. Biol. Chem., Jan 2008; 10.1074/jbc.M710422200.
[AGPAT2]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200228 | AGPAT2 (Myc-DDK-tagged)-Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1 |
CNY 3,600.00 |
|
RC200228L1 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200228L2 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC200228L3 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200228L4 | Lenti ORF clone of Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG200228 | AGPAT2 (tGFP-tagged) - Human 1-acylglycerol-3-phosphate O-acyltransferase 2 (lysophosphatidic acid acyltransferase, beta) (AGPAT2), transcript variant 1 |
CNY 4,370.00 |