United States
Germany
Japan
United Kingdom
China
AK2 (NM_001625) Human Untagged Clone
CAT＃: SC321133
AK2 (untagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ADK2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001625.2
GTGGCAGTGAGAGACTTCGGCGGACATGGCTCCCAGCGTGCCAGCGGCAGAACCCGAGTA
TCCTAAAGGCATCCGGGCCGTGCTGCTGGGGCCTCCCGGGGCCGGTAAAGGGACCCAGGC ACCCAGATTGGCTGAAAACTTCTGTGTCTGCCATTTAGCTACTGGGGACATGCTGAGGGC CATGGTGGCTTCTGGCTCAGAGCTAGGAAAAAAGCTGAAGGCAACTATGGATGCTGGGAA ACTGGTGAGTGATGAAATGGTAGTGGAGCTCATTGAGAAGAATTTGGAGACCCCCTTGTG CAAAAATGGTTTTCTTCTGGATGGCTTCCCTCGGACTGTGAGGCAGGCAGAAATGCTCGA TGACCTCATGGAGAAGAGGAAAGAGAAGCTTGATTCTGTGATTGAATTCAGCATCCCAGA CTCTCTGCTGATCCGAAGAATCACAGGAAGGCTGATTCACCCCAAGAGTGGCCGTTCCTA CCACGAGGAGTTCAACCCTCCAAAAGAGCCCATGAAAGATGACATCACCGGGGAACCCTT GATCCGTCGATCAGATGATAATGAAAAGGCCTTGAAAATCCGCCTGCAAGCCTACCACAC TCAAACCACCCCACTCATAGAGTACTACAGGAAACGGGGGATCCACTCCGCCATCGATGC ATCCCAGACCCCCGATGTCGTGTTCGCAAGCATCCTAGCAGCCTTCTCCAAAGCCACATG TAAAGACTTGGTTATGTTTATCTAATGTTGGGTCCAAGAAGGAATTTCTTTCCATCCCTG TGAGGCAATGGGTGGGAATGATAGGACAGGCAAAGAGAAGCTTCCTCAGGCTAGCAAAAA TATCATTTGATGTATTGATTAAAAAAGCACTTGCTTGATGTAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001625 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001625.2, NP_001616.1 |
| RefSeq Size | 961 bp |
| RefSeq ORF | 720 bp |
| Locus ID | 204 |
| UniProt ID | P54819 |
| Domains | ADK, ADK_lid |
| Protein Families | Druggable Genome |
| Protein Pathways | Metabolic pathways, Purine metabolism |
| Gene Summary | Adenylate kinases are involved in regulating the adenine nucleotide composition within a cell by catalyzing the reversible transfer of phosphate groups among adenine nucleotides. Three isozymes of adenylate kinase, namely 1, 2, and 3, have been identified in vertebrates; this gene encodes isozyme 2. Expression of these isozymes is tissue-specific and developmentally regulated. Isozyme 2 is localized in the mitochondrial intermembrane space and may play a role in apoptosis. Mutations in this gene are the cause of reticular dysgenesis. Alternate splicing results in multiple transcript variants. Pseudogenes of this gene are found on chromosomes 1 and 2.[provided by RefSeq, Nov 2010] Transcript Variant: This variant (1), also known as AK2A, encodes the longest isoform (a). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC209974 | AK2 (Myc-DDK-tagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
|
| RC209974L3 | Lenti ORF clone of Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC209974L4 | Lenti ORF clone of Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG209974 | AK2 (tGFP-tagged) - Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,000.00 |
|
| SC111586 | AK2 (untagged)-Human adenylate kinase 2 (AK2), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |
