United States
Germany
Japan
United Kingdom
China
VCY (VCY1B) (NM_181880) Human Untagged Clone
CAT＃: SC320986
VCY1B (untagged)-Human variable charge, Y-linked 1B (VCY1B)
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BPY1B |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_181880.1
GGGGGATACACAGGGAGGCCAGGCAGCCTGGAGTTAGTCGACCGTTGCGAGACGTTGAGC
TGCGGCAGATGAGTCCAAAGCCGAGAGCCTCGGGACCTCCGGCCAAGGCCAAGGAGACAG GAAAGAGGAAGTCCTCCTCTCAGCCGAGCCCCAGTGGCCCGAAGAAGAAGACTACCAAGG TGGCCGAGAAGGGAGAAGCAGTTCGTGGAGGGAGACGCGGGAAGAAAGGGGCTGCGACAA AGATGGCGGCCGTGACGGCACCTGAGGCGGAGAGCGGGCCAGCGGCACCCGGCCCCAGCG ACCAGCCCAGCCAGGAGCTCCCTCAGCACGAGCTGCCGCCGGAGGAGCCAGTGAGCGAGG GGACCCAGCACGACCCCCTGAGTCAGGAGAGCGAGCTGGAGGAACCACTGAGTAAGGGGC GCCCATCTACTCCCCTATCTCCCTGAGCAGCAACTAAGTTTAGGCCCAGCTGCCAGACCT CAGAGATCTCACCAGCAGGGTGCTTCCCATGTTGATGACAATAAAATGAATGTGTTGCAA ACCGAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_181880 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181880.1, NP_870996.1 |
| RefSeq Size | 573 bp |
| RefSeq ORF | 378 bp |
| Locus ID | 353513 |
| UniProt ID | O14598 |
| Gene Summary | The protein encoded by this gene is a member of a family of human VCX/Y genes. This gene family has multiple members on both X and Y chromosomes, and all are expressed exclusively in male germ cells. Members of the VCX/Y family share a high degree of sequence identity, with the exception that a 30-bp unit is tandemly repeated in X-linked members but occurs only once in Y-linked members. VCX/Y genes encode small and highly charged proteins of unknown function. This gene encodes a small, positively charged protein. The presence of a putative bipartite nuclear localization signal suggests that this gene encodes a nuclear protein. The genome has two identical copies of this gene within a palindromic region; this record represents the more telomeric copy. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208868 | VCY1B (Myc-DDK-tagged)-Human variable charge, Y-linked 1B (VCY1B) |
CNY 3,990.00 |
|
| RC208868L3 | Lenti-ORF clone of VCY1B (Myc-DDK-tagged)-Human variable charge, Y-linked 1B (VCY1B) |
CNY 5,890.00 |
|
| RC208868L4 | Lenti-ORF clone of VCY1B (mGFP-tagged)-Human variable charge, Y-linked 1B (VCY1B) |
CNY 5,890.00 |
|
| RG208868 | VCY1B (tGFP-tagged) - Human variable charge, Y-linked 1B (VCY1B) |
CNY 4,370.00 |
|
| SC125625 | VCY1B (untagged)-Human variable charge, Y-linked 1B (VCY1B) |
CNY 1,200.00 |
