EVA1 (MPZL2) (NM_005797) Human Untagged Clone
CAT#: SC320960
MPZL2 (untagged)-Human myelin protein zero-like 2 (MPZL2), transcript variant 1
CNY 3,600.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DFNB111; EVA; EVA1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_005797.2
ACAGGCACAGGTGAGGAACTCAACTCAAACTCCTCTCTCTGGGAAAACGCGGTGCTTGCT
CCTCCCGGAGTGGCCTTGGCAGGGTGTTGGAGCCCTCGGTCTGCCCCGTCCGGTCTCTGG GGCCAAGGCTGGGTTTCCCTCATGTATGGCAAGAGCTCTACTCGTGCGGTGCTTCTTCTC CTTGGCATACAGCTCACAGCTCTTTGGCCTATAGCAGCTGTGGAAATTTATACCTCCCGG GTGCTGGAGGCTGTTAATGGGACAGATGCTCGGTTAAAATGCACTTTCTCCAGCTTTGCC CCTGTGGGTGATGCTCTAACAGTGACCTGGAATTTTCGTCCTCTAGACGGGGGACCTGAG CAGTTTGTATTCTACTACCACATAGATCCCTTCCAACCCATGAGTGGGCGGTTTAAGGAC CGGGTGTCTTGGGATGGGAATCCTGAGCGGTACGATGCCTCCATCCTTCTCTGGAAACTG CAGTTCGACGACAATGGGACATACACCTGCCAGGTGAAGAACCCACCTGATGTTGATGGG GTGATAGGGGAGATCCGGCTCAGCGTCGTGCACACTGTACGCTTCTCTGAGATCCACTTC CTGGCTCTGGCCATTGGCTCTGCCTGTGCACTGATGATCATAATAGTAATTGTAGTGGTC CTCTTCCAGCATTACCGGAAAAAGCGATGGGCCGAAAGAGCTCATAAAGTGGTGGAGATA AAATCAAAAGAAGAGGAAAGGCTCAACCAAGAGAAAAAGGTCTCTGTTTATTTAGAAGAC ACAGACTAACAATTTTAGATGGTAAGGTTCACAAATAGGTTGATTTCTTTCTTCAGCTTT CTGACATGTCCAGCCCATCTCTAATGAGGACTCCCAGATCATCACTTTATGGCTGTTAGG TGTTTCCCATATGAAATTAGAGGAGCTGGGTCAGGGAGACAAAAGTCTTCTATTAGTCTT ATGGATAGCTCCTCCTTGAGTGTATTTTGTGCAAAAGATTAAGAAGCTGGACTCTACTGC CATTAAAGCTGAGAGAATCCTAAGGTTATTTGTGGCTTCGGGGTTATATTTATTACTACT ACTACTAATAAATATTCAACAAGTAAATAAATCTTTTTTAAATCAAAAAAAAAAAAAAAA AAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_005797 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_005797.2, NP_005788.1 |
RefSeq Size | 2634 bp |
RefSeq ORF | 648 bp |
Locus ID | 10205 |
UniProt ID | O60487 |
Domains | ig, IGv, IG |
Protein Families | Transmembrane |
Gene Summary | Thymus development depends on a complex series of interactions between thymocytes and the stromal component of the organ. Epithelial V-like antigen (EVA) is expressed in thymus epithelium and strongly downregulated by thymocyte developmental progression. This gene is expressed in the thymus and in several epithelial structures early in embryogenesis. It is highly homologous to the myelin protein zero and, in thymus-derived epithelial cell lines, is poorly soluble in nonionic detergents, strongly suggesting an association to the cytoskeleton. Its capacity to mediate cell adhesion through a homophilic interaction and its selective regulation by T cell maturation might imply the participation of EVA in the earliest phases of thymus organogenesis. The protein bears a characteristic V-type domain and two potential N-glycosylation sites in the extracellular domain; a putative serine phosphorylation site for casein kinase 2 is also present in the cytoplasmic tail. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC204628 | MPZL2 (Myc-DDK-tagged)-Human myelin protein zero-like 2 (MPZL2), transcript variant 1 |
CNY 3,600.00 |
|
RC204628L3 | Lenti ORF clone of Human myelin protein zero-like 2 (MPZL2), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC204628L4 | Lenti ORF clone of Human myelin protein zero-like 2 (MPZL2), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG204628 | MPZL2 (tGFP-tagged) - Human myelin protein zero-like 2 (MPZL2), transcript variant 1 |
CNY 5,200.00 |
|
SC126799 | MPZL2 (untagged)-Human myelin protein zero-like 2 (MPZL2), transcript variant 1 |
CNY 3,600.00 |