RPS3 (NM_001005) Human Untagged Clone
CAT#: SC320926
RPS3 (untagged)-Human ribosomal protein S3 (RPS3)
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | S3 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_001005.3
CCTTTCCTTTCAGCGGAGCGCGGCGGCAAGATGGCAGTGCAAATATCCAAGAAGAGGAAG
TTTGTCGCTGATGGCATCTTCAAAGCTGAACTGAATGAGTTTCTTACTCGGGAGCTGGCT GAAGATGGCTACTCTGGAGTTGAGGTGCGAGTTACACCAACCAGGACAGAAATCATTATC TTAGCCACCAGAACACAGAATGTTCTTGGTGAGAAGGGCCGGCGGATTCGGGAACTGACT GCTGTAGTTCAGAAGAGGTTTGGCTTTCCAGAGGGCAGTGTAGAGCTTTATGCTGAAAAG GTGGCCACTAGAGGTCTGTGTGCCATTGCCCAGGCAGAGTCTCTGCGTTACAAACTCCTA GGAGGGCTTGCTGTGCGGAGGGCCTGCTATGGTGTGCTGCGGTTCATCATGGAGAGTGGG GCCAAAGGCTGCGAGGTTGTGGTGTCTGGGAAACTCCGAGGACAGAGGGCTAAATCCATG AAGTTTGTGGATGGCCTGATGATCCACAGCGGAGACCCTGTTAACTACTACGTTGACACT GCTGTGCGCCACGTGTTGCTCAGACAGGGTGTGCTGGGCATCAAGGTGAAGATCATGCTG CCCTGGGACCCAACTGGTAAGATTGGCCCTAAGAAGCCCCTGCCTGACCACGTGAGCATT GTGGAACCCAAAGATGAGATACTGCCCACCACCCCCATCTCAGAACAGAAGGGTGGGAAG CCAGAGCCGCCTGCCATGCCCCAGCCAGTCCCCACAGCATAACAGGGTCTCCTTGGCAGC TGTATTCTGGAGTCTGGATGTTGCTCTCTAAAGACCTTTAATAAAATTTTGTACAAAGAC CAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_001005 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001005.3, NP_000996.2 |
RefSeq Size | 855 bp |
RefSeq ORF | 732 bp |
Locus ID | 6188 |
UniProt ID | P23396 |
Domains | Ribosomal_S3_C, KH |
Protein Pathways | Ribosome |
Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit, where it forms part of the domain where translation is initiated. The protein belongs to the S3P family of ribosomal proteins. Studies of the mouse and rat proteins have demonstrated that the protein has an extraribosomal role as an endonuclease involved in the repair of UV-induced DNA damage. The protein appears to be located in both the cytoplasm and nucleus but not in the nucleolus. Higher levels of expression of this gene in colon adenocarcinomas and adenomatous polyps compared to adjacent normal colonic mucosa have been observed. This gene is co-transcribed with the small nucleolar RNA genes U15A and U15B, which are located in its first and fifth introns, respectively. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Multiple alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2012] Transcript Variant: This variant (1) and variant 2 both encode the same protein (isoform 1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC205936 | RPS3 (Myc-DDK-tagged)-Human ribosomal protein S3 (RPS3) |
CNY 2,400.00 |
|
RC205936L1 | Lenti ORF clone of Human ribosomal protein S3 (RPS3), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC205936L2 | Lenti ORF clone of Human ribosomal protein S3 (RPS3), mGFP tagged |
CNY 5,890.00 |
|
RC205936L3 | Lenti ORF clone of Human ribosomal protein S3 (RPS3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC205936L4 | Lenti ORF clone of Human ribosomal protein S3 (RPS3), mGFP tagged |
CNY 4,800.00 |
|
RG205936 | RPS3 (tGFP-tagged) - Human ribosomal protein S3 (RPS3) |
CNY 4,000.00 |
|
SC119512 | RPS3 (untagged)-Human ribosomal protein S3 (RPS3) |
CNY 2,400.00 |