United States
Germany
Japan
United Kingdom
China
PEN2 (PSENEN) (NM_172341) Human Untagged Clone
CAT＃: SC320900
PSENEN (untagged)-Human presenilin enhancer 2 homolog (C. elegans) (PSENEN)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | ACNINV2; MDS033; MSTP064; PEN-2; PEN2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_172341.1
AGGGAAACCTGGGGCGTCTCGCGCAAACGTCCATAACTGAAAGTAGCTAAGGCACCCCTG
CCGGAGGAAGTGAGCTCTCCTGGGTCAAGGCTTGGGTCTTGCCCCGCAGACCCTTGGGAC GACCCGGCCCCAGCGCAGCTATGAACCTGGAGCGAGTGTCCAATGAGGAGAAATTGAACC TGTGCCGGAAGTACTACCTGGGGGGGTTTGCTTTCCTGCCTTTTCTCTGGTTGGTCAACA TCTTCTGGTTCTTCCGAGAGGCCTTCCTTGTCCCAGCCTACACAGAACAGAGCCAAATCA AAGGCTATGTCTGGCGCTCAGCTGTGGGCTTCCTCTTCTGGGTGATAGTGCTCACCTCCT GGATCACCATCTTCCAGATCTACCGGCCCCGCTGGGGTGCCCTTGGGGACTACCTCTCCT TCACCATACCCCTGGGCACCCCCTGACAACTTCTGCACATACTGGGGCCCTGCTTATTCT CCCAGGACAGGCTCCTTAAAGCAGAGGAGCCTGTCCTGGGAGCCCCTTCTCAAACTCCTA AGACTTGTTTTCATGTCCCACGTTCTCTGCTGACATCCCCCAATAAAGGACCCTAACTTT CGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_172341 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_172341.1, NP_758844.1 |
| RefSeq Size | 678 bp |
| RefSeq ORF | 306 bp |
| Locus ID | 55851 |
| UniProt ID | Q9NZ42 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Alzheimer's disease, Notch signaling pathway |
| Gene Summary | Presenilins, which are components of the gamma-secretase protein complex, are required for intramembranous processing of some type I transmembrane proteins, such as the Notch proteins and the beta-amyloid precursor protein. Signaling by Notch receptors mediates a wide range of developmental cell fates. Processing of the beta-amyloid precursor protein generates neurotoxic amyloid beta peptides, the major component of senile plaques associated with Alzheimer's disease. This gene encodes a protein that is required for Notch pathway signaling, and for the activity and accumulation of gamma-secretase. Mutations resulting in haploinsufficiency for this gene cause familial acne inversa-2 (ACNINV2). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) represents the longer transcript. Variants 1 and 2 encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC203272 | PSENEN (Myc-DDK-tagged)-Human presenilin enhancer 2 homolog (C. elegans) (PSENEN) |
CNY 1,200.00 |
|
| RC203272L1 | Lenti ORF clone of Human presenilin enhancer 2 homolog (C. elegans) (PSENEN), Myc-DDK-tagged |
CNY 3,600.00 |
|
| RC203272L2 | Lenti ORF clone of Human presenilin enhancer 2 homolog (C. elegans) (PSENEN), mGFP tagged |
CNY 5,890.00 |
|
| RC203272L3 | Lenti ORF clone of Human presenilin enhancer 2 homolog (C. elegans) (PSENEN), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC203272L4 | Lenti ORF clone of Human presenilin enhancer 2 homolog (C. elegans) (PSENEN), mGFP tagged |
CNY 5,890.00 |
|
| RG203272 | PSENEN (tGFP-tagged) - Human presenilin enhancer 2 homolog (C. elegans) (PSENEN) |
CNY 2,800.00 |
|
| SC309217 | PSENEN (untagged)-Human presenilin enhancer 2 homolog (C. elegans) (PSENEN) |
CNY 1,200.00 |
