EXOSC7 (NM_015004) Human Untagged Clone

CAT#: SC320874

EXOSC7 (untagged)-Human exosome component 7 (EXOSC7), transcript variant 1



  "NM_015004" in other vectors (7)

CN¥ 2,400.00

CN¥ 2,950.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
EXOSC7 mouse monoclonal antibody, clone OTI1G8 (formerly 1G8)
    • 100 ul

CN¥ 1,999.00
CN¥ 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CN¥ 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CN¥ 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CN¥ 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms EAP1; hRrp42p; p8; RRP42; Rrp42p
Vector pCMV6-AC
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>OriGene sequence for NM_015004.2 GGCAGCATGGCGTCCGTGACGCTGAGCGAGGCGGAGAAGGTGTACATCGTGCATGGCGTC
CAGGAAGACCTCCGTGTGGATGGCCGTGGCTGTGAGGACTACCGATGTGTCGAAGTGGAA
ACTGATGTGGTGTCCAACACTAGTGGGTCCGCCAGGGTCAAGCTGGGTCACACAGACATC
TTGGTGGGAGTGAAAGCAGAAATGGGGACGCCGAAGCTGGAGAAACCAAATGAAGGCTAC
TTGGAGTTCTTTGTTGACTGTTCAGCCAGTGCTACCCCTGAATTTGAAGGTAGAGGAGGT
GATGACCTTGGCACCGAGATCGCTAACACCCTCTATCGGATATTTAACAATAAAAGCAGT
GTCGACTTAAAGACCCTCTGCATTAGTCCTCGGGAGCACTGCTGGGTTCTCTATGTGGAT
GTGCTGCTTCTGGAATGTGGTGGAAATTTGTTTGATGCCATTTCCATTGCTGTAAAGGCT
GCTCTCTTCAATACAAGGATACCAAGGGTTCGAGTTTTGGAGGATGAAGAGGGGTCGAAG
GACATTGAATTGTCAGATGACCCTTATGACTGCATACGACTAAGTGTGGAGAATGTCCCC
TGCATTGTCACTCTGTGCAAGATTGGCTATCGGCATGTGGTGGATGCTACTCTTCAGGAG
GAGGCCTGCTCGCTGGCCAGCTTGCTGGTGTCGGTGACCAGCAAGGGAGTTGTGACGTGC
ATGAGGAAAGTGGGGAAGGGCAGCCTGGACCCAGAGAGCATCTTCGAGATGATGGAGACT
GGCAAGCGTGTGGGCAAGGTACTGCATGCCTCCTTGCAGAGTGTTCTGCACAAGGAAGAA
AGCCTGGGGCCCAAGAGACAGAAAGTTGGATTCCTGGGATGATTTGCACATCAACTGCTC
AACTGTGGATTGTTTTTTACTTTTCCTTTTAAACCGGTTCGTATATATTTTTCTTCGCTG
TTACGAATTTACAGCAGCATTTGTACATGTAAAATTAAAGGCTATTTTCTGGTAAAAAAA
AAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN NM_015004
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_015004.2, NP_055819.1
RefSeq Size 1036 bp
RefSeq ORF 876 bp
Locus ID 23016
UniProt ID Q15024
Domains RNase_PH_C
Protein Families Stem cell - Pluripotency
Protein Pathways RNA degradation
Gene Summary Non-catalytic component of the RNA exosome complex which has 3'->5' exoribonuclease activity and participates in a multitude of cellular RNA processing and degradation events. In the nucleus, the RNA exosome complex is involved in proper maturation of stable RNA species such as rRNA, snRNA and snoRNA, in the elimination of RNA processing by-products and non-coding 'pervasive' transcripts, such as antisense RNA species and promoter-upstream transcripts (PROMPTs), and of mRNAs with processing defects, thereby limiting or excluding their export to the cytoplasm. The RNA exosome may be involved in Ig class switch recombination (CSR) and/or Ig variable region somatic hypermutation (SHM) by targeting AICDA deamination activity to transcribed dsDNA substrates. In the cytoplasm, the RNA exosome complex is involved in general mRNA turnover and specifically degrades inherently unstable mRNAs containing AU-rich elements (AREs) within their 3' untranslated regions, and in RNA surveillance pathways, preventing translation of aberrant mRNAs. It seems to be involved in degradation of histone mRNA. The catalytic inactive RNA exosome core complex of 9 subunits (Exo-9) is proposed to play a pivotal role in the binding and presentation of RNA for ribonucleolysis, and to serve as a scaffold for the association with catalytic subunits and accessory proteins or complexes.[UniProtKB/Swiss-Prot Function]
Transcript Variant: This variant (1) encodes the protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...