United States
Germany
Japan
United Kingdom
China
RPLP2 (NM_001004) Human Untagged Clone
CAT＃: SC320833
RPLP2 (untagged)-Human ribosomal protein, large, P2 (RPLP2)
CNY 1,200.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | D11S2243E; LP2; P2; RPP2 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_001004.3
TTCCTTTTCCTCCCTGTCGCCACCGAGGTCGCACGCGTGAGACTTCTCCGCCGCCTCCGC
CGCAGACGCCGCCGCGATGCGCTACGTCGCCTCCTACCTGCTGGCTGCCCTAGGGGGCAA CTCCTCCCCCAGCGCCAAGGACATCAAGAAGATCTTGGACAGCGTGGGTATCGAGGCGGA CGACGACCGGCTCAACAAGGTTATCAGTGAGCTGAATGGAAAAAACATTGAAGACGTCAT TGCCCAGGGTATTGGCAAGCTTGCCAGTGTACCTGCTGGTGGGGCTGTAGCCGTCTCTGC TGCCCCAGGCTCTGCAGCCCCTGCTGCTGGTTCTGCCCCTGCTGCAGCAGAGGAGAAGAA AGATGAGAAGAAGGAGGAGTCTGAAGAGTCAGATGATGACATGGGATTTGGCCTTTTTGA TTAAATTCCTGCTCCCCTGCAAATAAAGCCTTTTTACACATCTAAAAAAAAAAAAAAAAA AAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001004 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001004.3, NP_000995.1 |
| RefSeq Size | 511 bp |
| RefSeq ORF | 348 bp |
| Locus ID | 6181 |
| UniProt ID | P05387 |
| Domains | 60s_ribosomal |
| Protein Families | Druggable Genome |
| Protein Pathways | Ribosome |
| Gene Summary | Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal phosphoprotein that is a component of the 60S subunit. The protein, which is a functional equivalent of the E. coli L7/L12 ribosomal protein, belongs to the L12P family of ribosomal proteins. It plays an important role in the elongation step of protein synthesis. Unlike most ribosomal proteins, which are basic, the encoded protein is acidic. Its C-terminal end is nearly identical to the C-terminal ends of the ribosomal phosphoproteins P0 and P1. The P2 protein can interact with P0 and P1 to form a pentameric complex consisting of P1 and P2 dimers, and a P0 monomer. The protein is located in the cytoplasm. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. [provided by RefSeq, Jul 2008] |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC202776 | RPLP2 (Myc-DDK-tagged)-Human ribosomal protein, large, P2 (RPLP2) |
CNY 1,200.00 |
|
| RC202776L3 | Lenti-ORF clone of RPLP2 (Myc-DDK-tagged)-Human ribosomal protein, large, P2 (RPLP2) |
CNY 5,890.00 |
|
| RC202776L4 | Lenti-ORF clone of RPLP2 (mGFP-tagged)-Human ribosomal protein, large, P2 (RPLP2) |
CNY 5,890.00 |
|
| RG202776 | RPLP2 (tGFP-tagged) - Human ribosomal protein, large, P2 (RPLP2) |
CNY 4,370.00 |
|
| SC119511 | RPLP2 (untagged)-Human ribosomal protein, large, P2 (RPLP2) |
CNY 1,200.00 |
