CLIC3 (NM_004669) Human Untagged Clone
CAT#: SC320820
CLIC3 (untagged)-Human chloride intracellular channel 3 (CLIC3)
CNY 2,400.00
CNY 3,990.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_004669.2
GCGCCTGACCGCGGCAGCTCCCACCATGGCGGAGACCAAGCTCCAGCTGTTTGTCAAGGC
GAGTGAGGACGGGGAGAGCGTGGGTCACTGCCCCTCCTGCCAGCGGCTCTTCATGGTCCT GCTCCTCAAGGGCGTACCTTTCACCCTCACCACGGTGGACACGCGCAGGTCCCCGGACGT GCTGAAGGACTTCGCCCCCGGCTCGCAGCTGCCCATCCTGCTCTATGACAGCGACGCCAA GACAGACACGCTGCAGATCGAGGACTTTCTGGAGGAGACGCTGGGGCCGCCCGACTTCCC CAGCCTGGCGCCTCGTTACAGGGAGTCCAACACCGCCGGCAACGACGTTTTCCACAAGTT CTCCGCGTTCATCAAGAACCCGGTGCCCGCGCAGGACGAAGCCCTGTACCAGCAGCTGCT GCGCGCCCTCGCCAGGCTGGACAGCTACCTGCGCGCGCCCCTGGAGCACGAGCTGGCGGG GGAGCCGCAGCTGCGCGAGTCCCGCCGCCGCTTCCTGGACGGCGACAGGCTCACGCTGGC CGACTGCAGCCTCCTGCCCAAGCTGCACATCGTCGACACGGTGTGCGCGCACTTCCGCCA GGCGCCCATCCCCGCGGAGCTGCGCGGCGTACGCCGCTACCTGGACAGCGCGATGCAGGA GAAAGAGTTCAAATACACGTGTCCGCACAGCGCCGAGATCCTGGCGGCCTACCGGCCCGC CGTGCACCCCCGCTAGCGCCCCACCCCGCGTCTGTCGCCCAATAAAGGCATCTTTGTCGT GAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_004669 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_004669.2, NP_004660.2 |
RefSeq Size | 813 bp |
RefSeq ORF | 711 bp |
Locus ID | 9022 |
UniProt ID | O95833 |
Protein Families | Druggable Genome, Ion Channels: Other |
Gene Summary | Chloride channels are a diverse group of proteins that regulate fundamental cellular processes including stabilization of cell membrane potential, transepithelial transport, maintenance of intracellular pH, and regulation of cell volume. Chloride intracellular channel 3 is a member of the p64 family and is predominantly localized in the nucleus and stimulates chloride ion channel activity. In addition, this protein may participate in cellular growth control, based on its association with ERK7, a member of the MAP kinase family. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202726 | CLIC3 (Myc-DDK-tagged)-Human chloride intracellular channel 3 (CLIC3) |
CNY 2,400.00 |
|
RC202726L3 | Lenti ORF clone of Human chloride intracellular channel 3 (CLIC3), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC202726L4 | Lenti ORF clone of Human chloride intracellular channel 3 (CLIC3), mGFP tagged |
CNY 5,890.00 |
|
RG202726 | CLIC3 (tGFP-tagged) - Human chloride intracellular channel 3 (CLIC3) |
CNY 4,000.00 |
|
SC122133 | CLIC3 (untagged)-Human chloride intracellular channel 3 (CLIC3) |
CNY 2,400.00 |