p21 Ras (HRAS) (NM_176795) Human Untagged Clone
CAT#: SC320717
HRAS (untagged)-Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2
CNY 3,600.00
Product images

Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C-BAS/HAS; C-H-RAS; C-HA-RAS1; CTLO; H-RASIDX; HAMSV; HRAS1; p21ras; RASH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_176795.2
GGCACGGGGGCAACCCGAGCCGCACCCGCCGCGGACGGAGCCCATGCGCGGGGCGAACCG
CGCGCCCCCGCCCCCGCCCCGCCCCGGCCTCGGCCCCGGCCCTGGCCCCGGGGGCAGTCG CGCCTGTGAACGGTGGGGCAGGAGACCCTGTAGGAGGACCCCGGGCCGCAGGCCCCTGAG GAGCGATGACGGAATATAAGCTGGTGGTGGTGGGCGCCGGCGGTGTGGGCAAGAGTGCGC TGACCATCCAGCTGATCCAGAACCATTTTGTGGACGAATACGACCCCACTATAGAGGATT CCTACCGGAAGCAGGTGGTCATTGATGGGGAGACGTGCCTGTTGGACATCCTGGATACCG CCGGCCAGGAGGAGTACAGCGCCATGCGGGACCAGTACATGCGCACCGGGGAGGGCTTCC TGTGTGTGTTTGCCATCAACAACACCAAGTCTTTTGAGGACATCCACCAGTACAGGGAGC AGATCAAACGGGTGAAGGACTCGGATGACGTGCCCATGGTGCTGGTGGGGAACAAGTGTG ACCTGGCTGCACGCACTGTGGAATCTCGGCAGGCTCAGGACCTCGCCCGAAGCTACGGCA TCCCCTACATCGAGACCTCGGCCAAGACCCGGCAGGGCAGCCGCTCTGGCTCTAGCTCCA GCTCCGGGACCCTCTGGGACCCCCCGGGACCCATGTGACCCAGCGGCCCCTCGCGCTGGA GTGGAGGATGCCTTCTACACGTTGGTGCGTGAGATCCGGCAGCACAAGCTGCGGAAGCTG AACCCTCCTGATGAGAGTGGCCCCGGCTGCATGAGCTGCAAGTGTGTGCTCTCCTGACGC AGCACAAGCTCAGGACATGGAGGTGCCGGATGCAGGAAGGAGGTGCAGACGGAAGGAGGA GGAAGGAAGGACGGAAGCAAGGAAGGAAGGAAGGGCTGCTGGAGCCCAGTCACCCCGGGA CCGTGGGCCGAGGTGACTGCAGACCCTCCCAGGGAGGCTGTGCACAGACTGTCTTGAACA TCCCAAATGCCACCGGAACCCCAGCCCTTAGCTCCCCTCCCAGGCCTCTGTGGGCCCTTG TCGGGCACAGATGGGATCACAGTAAATTATTGGATGGTCTTGAAAAAAAAAAAAAAAAAA AAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_176795 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_176795.2, NP_789765.1 |
RefSeq Size | 1143 bp |
RefSeq ORF | 513 bp |
Locus ID | 3265 |
UniProt ID | P01112 |
Protein Families | Druggable Genome |
Protein Pathways | Acute myeloid leukemia, Axon guidance, B cell receptor signaling pathway, Bladder cancer, Chemokine signaling pathway, Chronic myeloid leukemia, Endocytosis, Endometrial cancer, ErbB signaling pathway, Fc epsilon RI signaling pathway, Focal adhesion, Gap junction, Glioma, GnRH signaling pathway, Insulin signaling pathway, Long-term depression, Long-term potentiation, MAPK signaling pathway, Melanogenesis, Melanoma, Natural killer cell mediated cytotoxicity, Neurotrophin signaling pathway, Non-small cell lung cancer, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton, Renal cell carcinoma, T cell receptor signaling pathway, Thyroid cancer, Tight junction, VEGF signaling pathway |
Gene Summary | This gene belongs to the Ras oncogene family, whose members are related to the transforming genes of mammalian sarcoma retroviruses. The products encoded by these genes function in signal transduction pathways. These proteins can bind GTP and GDP, and they have intrinsic GTPase activity. This protein undergoes a continuous cycle of de- and re-palmitoylation, which regulates its rapid exchange between the plasma membrane and the Golgi apparatus. Mutations in this gene cause Costello syndrome, a disease characterized by increased growth at the prenatal stage, growth deficiency at the postnatal stage, predisposition to tumor formation, cognitive disability, skin and musculoskeletal abnormalities, distinctive facial appearance and cardiovascular abnormalities. Defects in this gene are implicated in a variety of cancers, including bladder cancer, follicular thyroid cancer, and oral squamous cell carcinoma. Multiple transcript variants, which encode different isoforms, have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) includes an alternate exon resulting in a frameshift and an early stop codon compared to variant 1. The encoded isoform (2) has a shorter and distinct C-terminus compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200739 | HRAS (Myc-DDK-tagged)-Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2 |
CNY 3,600.00 |
|
RC200739L1 | Lenti ORF clone of Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2, Myc-DDK-tagged |
CNY 6,000.00 |
|
RC200739L2 | Lenti ORF clone of Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC200739L3 | Lenti ORF clone of Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200739L4 | Lenti ORF clone of Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2, mGFP tagged |
CNY 6,000.00 |
|
RG200739 | HRAS (tGFP-tagged) - Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2 |
CNY 5,200.00 |
|
SC309327 | HRAS (untagged)-Human v-Ha-ras Harvey rat sarcoma viral oncogene homolog (HRAS), transcript variant 2 |
CNY 3,990.00 |
其它p21 Ras产品