OGG1 (NM_002542) Human Untagged Clone
CAT#: SC320638
OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a
CNY 5,488.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HMMH; HOGG1; MUTM; OGH1 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_002542.4
CACAGCTGTGCGCGCCCACAGGCTCTGGGGGCGGGAGAAGATAAGTCGCAAGGAGGGGGC
GGGACCTACACCTCAGGAAAGCCGGAGAATTGGGGCACGAAGCGGGGCTTTGATGACCCG CAAAGGGCGAGGCATGCAGGAGGTGGAGGAATTAAGTGAAACAGGGAAGGTTGTTAAACA GCACCGTGTGGGCGAGGCCTTAAGGGTCGTGGTCCTTGTCTGGGCGGGGTCTTTGGGCGT CGACGAGGCCTGGTTCTGGGTAGGCGGGGCTACTACGGGGCGGTGCCTGCTGTGGAAATG CCTGCCCGCGCGCTTCTGCCCAGGCGCATGGGGCATCGTACTCTAGCCTCCACTCCTGCC CTGTGGGCCTCCATCCCGTGCCCTCGCTCTGAGCTGCGCCTGGACCTGGTTCTGCCTTCT GGACAATCTTTCCGGTGGAGGGAGCAAAGTCCTGCACACTGGAGTGGTGTACTAGCGGAT CAAGTATGGACACTGACTCAGACTGAGGAGCAGCTCCACTGCACTGTGTACCGAGGAGAC AAGAGCCAGGCTAGCAGGCCCACACCAGACGAGCTGGAGGCCGTGCGCAAGTACTTCCAG CTAGATGTTACCCTGGCTCAACTGTATCACCACTGGGGTTCCGTGGACTCCCACTTCCAA GAGGTGGCTCAGAAATTCCAAGGTGTGCGACTGCTGCGACAAGACCCCATCGAATGCCTT TTCTCTTTTATCTGTTCCTCCAACAACAACATCGCCCGCATCACTGGCATGGTGGAGCGG CTGTGCCAGGCTTTTGGACCTCGGCTCATCCAGCTTGATGATGTCACCTACCATGGCTTC CCCAGCCTGCAGGCCCTGGCTGGGCCAGAGGTGGAGGCTCATCTCAGGAAGCTGGGCCTG GGCTATCGTGCCCGTTACGTGAGTGCCAGTGCCCGAGCCATCCTGGAAGAACAGGGCGGG CTAGCCTGGCTGCAGCAGCTACGAGAGTCCTCATATGAGGAGGCCCACAAGGCCCTCTGC ATCCTGCCTGGAGTGGGCACCAAGGTGGCTGACTGCATCTGCCTGATGGCCCTAGACAAG CCCCAGGCTGTGCCCGTGGATGTCCATATGTGGCACATTGCCCAACGTGACTACAGCTGG CACCCTACCACGTCCCAGGCGAAGGGACCGAGCCCCCAGACCAACAAGGAACTGGGAAAC TTTTTCCGGAGCCTGTGGGGACCTTATGCTGGCTGGGCCCAAGCGGTGCTGTTCAGTGCC GACCTGCGCCAATGCCGCCATGCTCAGGAGCCACCAGCAAAGCGCAGAAAGGGTTCCAAA GGGCCGGAAGGCTAGATGGGGCACCCTGGACAAAGAAATTCCCCAAGCACCTTCCCCTCC ATTCCCCACTTCTCTCTCCCCATCCCCACCCAGTCTCATGTTGGGGAGGGGCCTCCCTGT GACTACCTCAAAGGCCAGGCACCCCCAAATCAAGCAGTCAGTTTGCACAACAAGATGGGG TGGGGGATATTGAGGGAGACAGCGCTAAGGATGGTTTTATCTTCCCTTTATTACAAGAAG GAACAATAAAATAGAAACATTTGTATGGAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002542 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002542.4, NP_002533.1 |
RefSeq Size | 2557 bp |
RefSeq ORF | 1038 bp |
Locus ID | 4968 |
UniProt ID | O15527 |
Domains | HHH, ENDO3c |
Protein Families | Druggable Genome |
Protein Pathways | Base excision repair |
Gene Summary | This gene encodes the enzyme responsible for the excision of 8-oxoguanine, a mutagenic base byproduct which occurs as a result of exposure to reactive oxygen. The action of this enzyme includes lyase activity for chain cleavage. Alternative splicing of the C-terminal region of this gene classifies splice variants into two major groups, type 1 and type 2, depending on the last exon of the sequence. Type 1 alternative splice variants end with exon 7 and type 2 end with exon 8. All variants share the N-terminal region in common, which contains a mitochondrial targeting signal that is essential for mitochondrial localization. Many alternative splice variants for this gene have been described, but the full-length nature for every variant has not been determined. [provided by RefSeq, Aug 2008] Transcript Variant: Transcript variant 1a represents the predominant form of this gene. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC200522 | OGG1 (Myc-DDK-tagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a |
CNY 5,488.00 |
|
RC200522L1 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, Myc-DDK-tagged |
CNY 7,888.00 |
|
RC200522L2 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, mGFP tagged |
CNY 5,890.00 |
|
RC200522L3 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC200522L4 | Lenti ORF clone of Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a, mGFP tagged |
CNY 7,888.00 |
|
RG200522 | OGG1 (tGFP-tagged) - Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a |
CNY 7,088.00 |
|
SC309025 | OGG1 (untagged)-Human 8-oxoguanine DNA glycosylase (OGG1), nuclear gene encoding mitochondrial protein, transcript variant 1a |
CNY 5,488.00 |