United States
Germany
Japan
United Kingdom
China
Rab9 (RAB9A) (NM_004251) Human Untagged Clone
CAT＃: SC320415
RAB9A (untagged)-Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1
CNY 2,400.00
CNY 2,950.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | RAB9 |
| Vector | pCMV6-AC |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_004251.3
CTCTGTCCTCATTGCGCCCAGACGGGCCGGCCCAGAGCTCCCGGGTCGTCTTTCGTGTGG
CCGCGAGACACTCTTGCACTCCTGTAATGAGCCTGGCACTGTGATGAAACACTTTTCCCG TGTCGTTTGAGTGCATCTTCTCAACAACCCTAGGAGGGTTCTTGAAGCTTTTGAGATTAA CAATGGCAGGAAAATCATCACTTTTTAAAGTAATTCTCCTTGGAGATGGTGGAGTTGGGA AGAGTTCACTTATGAACAGATATGTAACTAATAAGTTTGATACCCAGCTCTTCCATACAA TAGGTGTGGAATTTTTAAATAAAGATTTGGAAGTGGATGGACATTTTGTTACCATGCAGA TTTGGGACACGGCAGGTCAGGAGCGATTCCGAAGCCTGAGGACACCATTTTACAGAGGTT CTGACTGCTGCCTGCTTACTTTTAGTGTCGATGATTCACAAAGCTTCCAGAACTTAAGTA ACTGGAAGAAAGAATTCATATATTATGCAGATGTGAAAGAGCCTGAGAGCTTTCCTTTTG TGATTCTGGGTAACAAGATTGACATAAGCGAACGGCAGGTGTCTACAGAAGAAGCCCAAG CTTGGTGCAGGGACAACGGCGACTATCCTTATTTTGAAACAAGTGCAAAAGATGCCACAA ATGTGGCAGCAGCCTTTGAGGAAGCGGTTCGAAGAGTTCTTGCTACCGAGGATAGGTCAG ATCATTTGATTCAGACAGACACAGTCAATCTTCACCGAAAGCCCAAGCCTAGCTCATCTT GCTGTTGATTGTTAGATTGTTGATGCATTCTAACCAACTCACACATATACACAAAATCAA CATGGGGATGGAGAAGAGAATTAGCGTTTGCAGCAGTGTATCATCTACTAATAAAATTAA ACTAATGTTGCTGCTTCATTAGTTGGTGGGAGAAGGGACACATCCACTCTTGGAGGAATA TATTTACTCAATAATGGCACCTTACATTTATAAATTGTAACAGTTGTCTAATAACGTTTC TTTAATTTAAATATGTAAGTTGCAGAGCTAATAAATGAAATGACCAAGACTTTAATTATA AAAAAAAAAAAAAAAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_004251 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_004251.3, NP_004242.1 |
| RefSeq Size | 1097 bp |
| RefSeq ORF | 606 bp |
| Locus ID | 9367 |
| UniProt ID | P51151 |
| Domains | ras, RAN, RAS, RHO, RAB |
| Protein Families | Druggable Genome |
| Gene Summary | Involved in the transport of proteins between the endosomes and the trans Golgi network. Involved in the recruitment of SGSM2 to melanosomes and is required for the proper trafficking of melanogenic enzymes TYR, TYRP1 and DCT/TYRP2 to melanosomes in melanocytes.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longer transcript. Variants 1 and 2 both encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC205698 | RAB9A (Myc-DDK-tagged)-Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1 |
CNY 2,400.00 |
|
| RC205698L1 | Lenti ORF clone of Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC205698L2 | Lenti ORF clone of Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC205698L3 | Lenti ORF clone of Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC205698L4 | Lenti ORF clone of Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG205698 | RAB9A (tGFP-tagged) - Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1 |
CNY 4,370.00 |
|
| SC117459 | RAB9A (untagged)-Human RAB9A, member RAS oncogene family (RAB9A), transcript variant 1 |
CNY 2,400.00 |
