CK1 epsilon (CSNK1E) (NM_152221) Human Untagged Clone
CAT#: SC320172
CSNK1E (untagged)-Human casein kinase 1, epsilon (CSNK1E), transcript variant 1
CNY 3,656.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CKIe; CKIepsilon; HCKIE |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene sequence for NM_152221.2
CCGCCCGCGGCAGCCCCCCGAGCAGTGGCCCGGCATCGGCGCCTTCCCGGCGGGCAAGAG
TGAGCCATGGAGCTACGTGTGGGGAACAAGTACCGCCTGGGACGGAAGATCGGGAGCGGG TCCTTCGGAGATATCTACCTGGGTGCCAACATCGCCTCTGGTGAGGAAGTCGCCATCAAG CTGGAGTGTGTGAAGACAAAGCACCCCCAGCTGCACATCGAGAGCAAGTTCTACAAGATG ATGCAGGGTGGCGTGGGGATCCCGTCCATCAAGTGGTGCGGAGCTGAGGGCGACTACAAC GTGATGGTCATGGAGCTGCTGGGGCCTAGCCTCGAGGACCTGTTCAACTTCTGTTCCCGC AAATTCAGCCTCAAGACGGTGCTGCTCTTGGCCGACCAGATGATCAGCCGCATCGAGTAT ATCCACTCCAAGAACTTCATCCACCGGGACGTCAAGCCCGACAACTTCCTCATGGGGCTG GGGAAGAAGGGCAACCTGGTCTACATCATCGACTTCGGCCTGGCCAAGAAGTACCGGGAC GCCCGCACCCACCAGCACATTCCCTACCGGGAAAACAAGAACCTGACCGGCACGGCCCGC TACGCTTCCATCAACACGCACCTGGGCATTGAGCAAAGCCGTCGAGATGACCTGGAGAGC CTGGGCTACGTGCTCATGTACTTCAACCTGGGCTCCCTGCCCTGGCAGGGGCTCAAAGCA GCCACCAAGCGCCAGAAGTATGAACGGATCAGCGAGAAGAAGATGTCAACGCCCATCGAG GTCCTCTGCAAAGGCTATCCCTCCGAATTCTCAACATACCTCAACTTCTGCCGCTCCCTG CGGTTTGACGACAAGCCCGACTACTCTTACCTACGTCAGCTCTTCCGCAACCTCTTCCAC CGGCAGGGCTTCTCCTATGACTACGTCTTTGACTGGAACATGCTGAAATTCGGTGCAGCC CGGAATCCCGAGGATGTGGACCGGGAGCGGCGAGAACACGAACGCGAGGAGAGGATGGGG CAGCTACGGGGGTCCGCGACCCGAGCCCTGCCCCCTGGCCCACCCACGGGGGCCACTGCC AACCGGCTCCGCAGTGCCGCCGAGCCCGTGGCTTCCACGCCAGCCTCCCGCATCCAGCCG GCTGGCAATACTTCTCCCAGAGCGATCTCGCGGGTCGACCGGGAGAGGAAGGTGAGTATG AGGCTGCACAGGGGTGCGCCCGCCAACGTCTCCTCCTCAGACCTCACTGGGCGGCAAGAG GTCTCCCGGATCCCAGCCTCACAGACAAGTGTGCCATTTGACCATCTCGGGAAGTGAGGA GAGCCCCCATTGGACCAGTGTTTGCTTAGTGTCTTCACTGTATTTTCTTTAAAAAAAAAA AAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_152221 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_152221.2, NP_689407.1 |
RefSeq Size | 2820 bp |
RefSeq ORF | 1251 bp |
Locus ID | 1454 |
UniProt ID | P49674 |
Domains | pkinase, TyrKc, S_TKc |
Protein Families | Druggable Genome, Protein Kinase |
Protein Pathways | Circadian rhythm - mammal, Hedgehog signaling pathway, Wnt signaling pathway |
Gene Summary | The protein encoded by this gene is a serine/threonine protein kinase and a member of the casein kinase I protein family, whose members have been implicated in the control of cytoplasmic and nuclear processes, including DNA replication and repair. The encoded protein is found in the cytoplasm as a monomer and can phosphorylate a variety of proteins, including itself. This protein has been shown to phosphorylate period, a circadian rhythm protein. Two transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Feb 2014] Transcript Variant: This variant (1) represents the longer and predominant transcript. Both variants 1 and 2 encode the same protein. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC202436 | CSNK1E (Myc-DDK-tagged)-Human casein kinase 1, epsilon (CSNK1E), transcript variant 1 |
CNY 3,656.00 |
|
RC202436L1 | Lenti ORF clone of Human casein kinase 1, epsilon (CSNK1E), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC202436L2 | Lenti ORF clone of Human casein kinase 1, epsilon (CSNK1E), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC202436L3 | Lenti ORF clone of Human casein kinase 1, epsilon (CSNK1E), transcript variant 1, Myc-DDK-tagged |
CNY 6,056.00 |
|
RC202436L4 | Lenti ORF clone of Human casein kinase 1, epsilon (CSNK1E), transcript variant 1, mGFP tagged |
CNY 6,056.00 |
|
RG202436 | CSNK1E (tGFP-tagged) - Human casein kinase 1, epsilon (CSNK1E), transcript variant 1 |
CNY 5,256.00 |
|
SC323364 | CSNK1E (untagged)-Kinase deficient mutant (K38M) of Human casein kinase 1, epsilon (CSNK1E), transcript variant 1 |
CNY 3,656.00 |
其它CK1 epsilon产品